Taxon Name
Saccharomyces cerevisiae Meyen ex E.C. Hansen
Accession number
1373
Form of supply
agar slant
Synonymous
Candida robusta Diddens & Lodder, Cryptococcus fermentans (Mrak & McClung) C.E. Skinner et al., Hormiscium cerevisiae Bail, Mycotorula robusta (Diddens & Lodder) Krasil\’nikov, Saccharomyces aceti Santa María, Saccharomyces acidosaccharophillii Kawano et
Restrictions on use
For commercial development a special agreement is requested
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Risk Group
1
GMO
No
Isolation source
soil
Isolation Locality
NLD – The Netherlands
Received from
Capriotti – Univ. Perugia, Italy
Date of deposit
01/01/1952
LSU (D1/D2)
Saccharomyces_cerevisiae_DBVPG1373_D1D2 CTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Cubillos et al.. Generation of a large set of genetically tractable haploid and diploid Saccharomyces strains. FEMS Yeast Res. (2009), 9: 1217-1225 DOI: 10.1111/j.1567-1364.2009.00583.x
Liti et al.. Sequence diversity, reproductive isolation and species concepts in Saccharomyces. Genetics (2006), 174: 839-850 DOI: 10.1534/genetics.106.062166
Almeida et al. A population genomics insight into the Mediterranean origins of wine yeast domestication. Molec.Ecol. (2015), 24: 5412-5427 DOI: 10.1111/mec.13341
Liti et al.. Inferences of evolutionary relationships from a population survey of LTR-retrotransposons and telomeric-associated sequences in the Saccharomyces sensu stricto complex. Yeast (2005), 22: 177-192 DOI: 10.1002/yea.1200
MacKenzie et al.. Relatedness of medically important strains of Saccharomyces cerevisiae as revealed by phylogenetics and metabolomics. Yeast (2008), 25: 501-512 DOI: 10.1002/yea.1601

Request information

Insert your data to get information about this yeast

    Arrow Down
    Arrow Up