Taxon Name
Brettanomyces anomalus Custer
Accession number
4075
Form of supply
agar slant
Synonymous
Dekkera anomala M.T. Smith & van Grinsven, Brettanomyces cidri Legakis, Brettanomyces claussenii Custers var. claussenii, Brettanomyces claussenii Custers var. sablieri Legakis, Brettanomyces dublinensis Gilliland, Candida beijingensis J.Z. Yue, Dekkera c
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 10559; CBS 77; CCRC 21512; IFO 0796; NRRL Y-1415; VKM Y-19
Risk Group
1
GMO
No
Status of the strain
Isotype of Brettanomyces anomalus Custers
Isolation source
stout beer
Isolation Locality
GBR – Great Britain
Received from
Date of deposit
01/01/1965
LSU (D1/D2)
GenBank AY969052; Brettanomyces_anomalus_DBVPG4075_D1D2 TGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCAGGCCCTCGCGGCTTGAGTTGTAATTTGGAGACGGGATACTAGAGAGAGGGAGGGCGACTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAGTCGCGTGAACTTGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGCAGGCGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCCAGCCAGACGTGGCTATCCGGGACCGGGGACTGCGGCGATTCTATCGCCAAGGATGCTGGCAGAACGAGCAAATACCGCCCGTCTTGA
18S rRNA
GenBank D32116
ITS1&2
GenBank AF043510
Recommended growth temperature
25°C
Recommended growth medium
YPDA+CaCO3 (Yeast Extract Peptone Glucose Agar with addition of CaCO3)
Jpapers
DOI Number: 10.1002/yea.320060403
Title: Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology
Authors: Smith et al.
Journal: Yeast
Year: 1990
DOI Number: 10.1006/fmic.1998.0217
Title: Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods
Authors: Mitrakul et al.
Journal: Food Microbiol.
Year: 1999
DOI Number: 10.1007/BF00160482
Title: Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order
Authors: Hoeben et al.
Journal: J.Mol.Evol.
Year: 1993
DOI Number: 10.1007/BF00365677
Title: Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts
Authors: McArthur, Clark-Walker
Journal: Curr.Genet
Year: 1983
DOI Number: 10.1271/bbb.58.1803
Title: The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995

Request information

Insert your data to get information about this yeast

    Arrow Down
    Arrow Up