Taxon Name
Naganishia diffluens (Zach) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6002
Form of supply
Agar
Synonymous
Cryptococcus albidus (Saito) C.E. Skinner var. diffluens (Zach) Phaff & Fell, Cryptococcus diffluens (Zach) Lodder & Kreger-van Rij var. uruguaiensis Artagaveytia-Allende & Aciole de Queiroz, Rhodotorula diffluens (Zach) T. Hasegawa et al., Rhodotorula ge
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 12307; CBS 160; IFO 0612; IGC 2872; JCM 3688; MUCL 30402; NRRL Y-1505; VKM Y-1592
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis diffluens Zach
Isolation source
diseased fingernails
Isolation Locality
AUT – Austria
Received from
CBS, Delft, The Netherlands
LSU (D1/D2)
GenBank AF075502; Naganishia_diffluens_DBVPG6002_D1D2
CGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTT
GTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTC
ATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAA
CGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGA
AAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTC
TTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGAGCGATGGATAAAGGCACT
AGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTAGCGTCATATACATTGTTTGGGACTG
AGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACA
TAATGGCTTTAAACGACCCGTC
18S rRNA
GenBank AB032617
ITS1&2
GenBank AF145330
Recommended growth temperature
20°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Scorzetti et al.. Cryptococcus adeliensis sp. nov., a xylanase producing basidiomycetous yeast from Antarctica. A.v.Leeuwenhoek (2000), 77: 153-157 DOI: 10.1023/A:1002124504936
Wolfram, Zach. Uber durch niedere Pilze verursachte Nagelerkrankungen beim Menschen. Arch.Dermatol.Syph. (1934), 170: 681-694
Brandt, Zach. Dermatol.Wochenschr. (1934), 105: 1180-
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Fell et al.. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int.J.Syst.Bacteriol. (1999), 49: 907-913 DOI: 10.1099/00207713-49-2-907
Sugita et al.. Intraspecies Diversity of Cryptococcus albidus Isolated from Humans as Revealed by Sequences of the Internal Transcribed Spacer Regions. Microbiol.Immunol. (2001), 45: 291-297 DOI: 10.1111/j.1348-0421.2001.tb02621.x Citations: 26
Sugita et al.. The Basidiomycetous Yeasts Cryptococcus diffluens and C. liquefaciens Colonize the Skin of Patients with Atopic Dermatitis. Microbiol.Immunol. (2003), 47: 945-950 DOI: 10.1111/j.1348-0421.2003.tb03468.x
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Wolfram, Zach. Uber durch niedere Pilze verursachte Nagelerkrankungen beim Menschen. Arch.Dermatol.Syph. (1934), 170: 681-694
Brandt, Zach. Dermatol.Wochenschr. (1934), 105: 1180-
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Fell et al.. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int.J.Syst.Bacteriol. (1999), 49: 907-913 DOI: 10.1099/00207713-49-2-907
Sugita et al.. Intraspecies Diversity of Cryptococcus albidus Isolated from Humans as Revealed by Sequences of the Internal Transcribed Spacer Regions. Microbiol.Immunol. (2001), 45: 291-297 DOI: 10.1111/j.1348-0421.2001.tb02621.x Citations: 26
Sugita et al.. The Basidiomycetous Yeasts Cryptococcus diffluens and C. liquefaciens Colonize the Skin of Patients with Atopic Dermatitis. Microbiol.Immunol. (2003), 47: 945-950 DOI: 10.1111/j.1348-0421.2003.tb03468.x
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Request information
Insert your data to get information about this yeast