Taxon Name
Phaeotremella skinneri (Phaff & Carmo Souza) A.M. Yurkov & T. Boekhout
Accession number
6011
Form of supply
Agar
Synonymous
Cryptococcus skinneri Phaff & do-Carmo-Sousa
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24199; CBS 5029; CCRC 21577; IFO 1872; IGC 3850; MUCL 30437; NRRL Y-5851; UCD 60-82; JCM 9039
Risk Group
1
GMO
No
Status of the strain
Isotype of Cryptococcus skinneri Phaff & do Carmo-Sousa
Isolation source
insect frass
Isolation Locality
USA – United States of America
Received from
LSU (D1/D2)
GenBank AF189835; Phaeotremella_skinneri_DBVPG6011_D1D2
CGGCGAGTGAACCGGGAAGAGCTCAAATTTGTAATCTGGCCCTTGGGTCCGAGTTGTAAT
CTATAGAGGCGTTTTCCGCGCCGGACCGTGTCCAAGTCCCTTGGAATAGGGTATCAAAGA
GGGTGACAATCCCGTACTTGACACGACGACCGGTGCTATGTGATACGTCTTCGACGAGTC
GAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGG
CGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGA
GTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGTGTCGGTCGGA
TTCAGCCTGGTCTCCAGGTGTATTTCCTTCCGACGGGTCAACATCAGTTTGGATCGGCGG
ATAAAGATGGAGGGAAGGTGGCACCTTCGGGTGTGTTATAGCCCTCTGTTGCATACGCTG
GTCTGGACTGAGGCATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAG
GATGTTGACGTAATGGCTTTAAACGACCCGTCTT
18S rRNA
GenBank AB032646
ITS1&2
GenBank AF444305
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1007/BF02538734
Title: Four new species of yeast isolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent
Authors: Phaff, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962
Title: Four new species of yeast isolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent
Authors: Phaff, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1016/S1567-1356(02)00128-9
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
DOI Number: 10.1099/00207713-50-3-1351
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Request information
Insert your data to get information about this yeast
