Taxon Name
Vanrija humicola (Dasz.) R.T. Moore
Accession number
6019
Form of supply
agar slant
Synonymous
Cryptococcus humicola (Daszewska) Golubev, Apiotrichum humicola (Daszewska) von Arx & Weijman, Azymoprocandida humicola (Daszewska) E.K. Novák & Zsolt, Candida humicola (Daszewska) Diddens & Lodder, Mycotorula humicola (Daszewska) F.C. Harrison, Torula humicola Daszewska, Vanrijia humicola (Daszewska) R.T. Moore, Candida suaveolens (Lindner) Langeron & Guerra Nadsonia slovaka Kocková-Kratochv¡lová & Svobodová-Polákov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 14438; CBS 571; CCRC 21639; IFO 0760; IGC 3387; JCM 1457; NCYC 818; NRRL Y-12944; MUCL 29840; VKM Y-2238; VKPM Y 221
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula humicola Daszewska
Isolation source
soil
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
21/10/1996
LSU (D1/D2)
GenBank AF189836; Vanrija_humicola_DBVPG6019_D1D2
ATCTATAGAAGTGTTTTCCGTGCTGGACCATGTCCAAGTCCCTTGGAACAGGGTATCAAA
GAGGGTGACAATCCCGTACTTGACATGACCACCAGTGCTCTGTGATACACTTTCTACGAG
TCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATT
GGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGA
GAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCATTG
GACTCAGCCGGTTTTCGGTGTATTTCCTTTGAACGGGTCAACATCAGTTTTGTCCGGTGG
ATAAAGGCAGGAAGAAAGTGGCTCCCTCGGGAGTGTTATAGCTTTCTGTCACATACACTG
GAGGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGGGTTCGCCCACGTTCGAGCTTAGG
ATGTTGACATAATGGCTTTAAACGACCCGTCTTG
18S rRNA
GenBank AB032637
ITS1&2
GenBank AF410470
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Daszewska. Bull.Soc.Bot.Genève (1912), 4: 255-316
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Takashima et al.. Reclassification of the Cryptococcus humicola complex. Int.J.Syst.Evol.Microbiol. (2001), 51: 2199-2210 DOI: 10.1099/00207713-51-6-2199
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Sugita et al.. Phylogenetic and Taxonomic Heterogeneity of Cryptococcus humicolus by Analysis of the Sequences of the Internal Transcribed Spacer Regions and 18S rDNA, and the Phylogenetic Relationships of C. humicolus, C. curvatus, and the Genus Trichosporon. Microbiol.Immunol. (2000), 44: 455-461 DOI: 10.1111/j.1348-0421.2000.tb02520.x
Laaser et al.. Ribosomal DNA Restriction Fragment Analysis as a Taxonomic Tool in Separating Physiologically Similar Basidiomycetous Yeasts. Syst.Appl.Microbiol (1989), 11: 170-175 DOI: 10.1016/S0723-2020(89)80057-8
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Takashima et al.. Reclassification of the Cryptococcus humicola complex. Int.J.Syst.Evol.Microbiol. (2001), 51: 2199-2210 DOI: 10.1099/00207713-51-6-2199
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Sugita et al.. Phylogenetic and Taxonomic Heterogeneity of Cryptococcus humicolus by Analysis of the Sequences of the Internal Transcribed Spacer Regions and 18S rDNA, and the Phylogenetic Relationships of C. humicolus, C. curvatus, and the Genus Trichosporon. Microbiol.Immunol. (2000), 44: 455-461 DOI: 10.1111/j.1348-0421.2000.tb02520.x
Laaser et al.. Ribosomal DNA Restriction Fragment Analysis as a Taxonomic Tool in Separating Physiologically Similar Basidiomycetous Yeasts. Syst.Appl.Microbiol (1989), 11: 170-175 DOI: 10.1016/S0723-2020(89)80057-8
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Request information
Insert your data to get information about this yeast