Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Vanrija humicola (Dasz.) R.T. Moore
Accession number
6019
Form of supply
agar slant
Synonymous
Cryptococcus humicola (Daszewska) Golubev, Apiotrichum humicola (Daszewska) von Arx & Weijman, Azymoprocandida humicola (Daszewska) E.K. Novák & Zsolt, Candida humicola (Daszewska) Diddens & Lodder, Mycotorula humicola (Daszewska) F.C. Harrison, Torula humicola Daszewska, Vanrijia humicola (Daszewska) R.T. Moore, Candida suaveolens (Lindner) Langeron & Guerra Nadsonia slovaka Kocková-Kratochv¡lová & Svobodová-Polákov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 14438; CBS 571; CCRC 21639; IFO 0760; IGC 3387; JCM 1457; NCYC 818; NRRL Y-12944; MUCL 29840; VKM Y-2238; VKPM Y 221
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula humicola Daszewska
Isolation source
soil
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
21/10/1996
LSU (D1/D2)
GenBank AF189836; Vanrija_humicola_DBVPG6019_D1D2
ATCTATAGAAGTGTTTTCCGTGCTGGACCATGTCCAAGTCCCTTGGAACAGGGTATCAAA
GAGGGTGACAATCCCGTACTTGACATGACCACCAGTGCTCTGTGATACACTTTCTACGAG
TCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATT
GGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGA
GAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCATTG
GACTCAGCCGGTTTTCGGTGTATTTCCTTTGAACGGGTCAACATCAGTTTTGTCCGGTGG
ATAAAGGCAGGAAGAAAGTGGCTCCCTCGGGAGTGTTATAGCTTTCTGTCACATACACTG
GAGGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGGGTTCGCCCACGTTCGAGCTTAGG
ATGTTGACATAATGGCTTTAAACGACCCGTCTTG
18S rRNA
GenBank AB032637
ITS1&2
GenBank AF410470
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1016/S0723-2020(11)80239-0
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
DOI Number: 10.1016/S0723-2020(89)80057-8
Title: Ribosomal DNA Restriction Fragment Analysis as a Taxonomic Tool in Separating Physiologically Similar Basidiomycetous Yeasts
Authors: Laaser et al.
Journal: Syst.Appl.Microbiol
Year: 1989
Title: Ribosomal DNA Restriction Fragment Analysis as a Taxonomic Tool in Separating Physiologically Similar Basidiomycetous Yeasts
Authors: Laaser et al.
Journal: Syst.Appl.Microbiol
Year: 1989
DOI Number: 10.1099/00207713-50-3-1351
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
DOI Number: 10.1099/00207713-51-6-2199
Title: Reclassification of the Cryptococcus humicola complex
Authors: Takashima et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
Title: Reclassification of the Cryptococcus humicola complex
Authors: Takashima et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
DOI Number: 10.1111/j.1348-0421.2000.tb02520.x
Title: Phylogenetic and Taxonomic Heterogeneity of Cryptococcus humicolus by Analysis of the Sequences of the Internal Transcribed Spacer Regions and 18S rDNA, and the Phylogenetic Relationships of C. humicolus, C. curvatus, and the Genus Trichosporon
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2000
Title: Phylogenetic and Taxonomic Heterogeneity of Cryptococcus humicolus by Analysis of the Sequences of the Internal Transcribed Spacer Regions and 18S rDNA, and the Phylogenetic Relationships of C. humicolus, C. curvatus, and the Genus Trichosporon
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2000
DOI Number: 10.1128/JCM.39.11.4042-4051.2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
Request information
Insert your data to get information about this yeast