Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Tetrapisispora phaffii (Van der Walt) Ueda-Nishimura & Mikata
Accession number
6076
Form of supply
agar slant
Synonymous
Fabospora phaffii Van der Walt, Kluyveromyces phaffii Van der Walt
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24235; CBS 4417; IFO 1672; NRRL Y-8282; UCD 70-5
Risk Group
1
GMO
No
Status of the strain
Isotype of Fabospora phaffii Van der Walt
Isolation source
uncultivated surface soil
Isolation Locality
ZAF – South Africa
Received from
Marty Miller – USA – University of California – Davis
LSU (D1/D2)
GenBank U69578
18S rRNA
GenBank X89525
ITS1&2
GenBank AY046176; Tetrapisispora_phaffii_DBVPG6076_ITS
ACACGTGGAGGATTTTTTTACAATACTTCTGAGAAACACCGACAACTTTTTTATTACAGC
AGTCAGCCGGATTTCTTAATTGAAAACAATAATTAAAACTTTCAACAACGGATCTCTTGG
TTCTCGCGCCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCATAATTCCG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCCACAGTATTCTGTGGGGCATGCCTGT
TTGAGCGTCATTTCCTTCTCAGCAAGCGATTGTTGGTTGTGAGTGATACTCTGCGAGTTA
GCTTGAAAGTGATACCAGGCGGAGTGCCATGCGAAATGGGACGGACGCGAATGAGTTAGG
TTTTTCCAAGTCGTTTGTGTTTTGTTCTGGGGCGCGTGGGAAGCCGCTAGTCGTAAAACG
GACACAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAG
CGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTC
AAATTTGAAATCTGGTACCTGTGGTGCCCGAGTTGTAATTTGTAGAGCAGGACTCCAGCA
GCGGCCTTTGCCTATGTTCTTTGGAACAAGACGTCATGGAGGGTGATAATCCCGTATGGC
GGGGGCCCCGCTGCGGTGTGAGTGCTGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTC
TAAGTGGGGTGGTATACTCCATCTAAAGCTAAATATCAGCGAGAGACCGATAGCGAACAA
GTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTG
TTGAAAGGGAAGGGCATTTGATCAGACATGGTAGGCAGCGCCCTGCGCCCCT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1007/BF02046076
Title: Fabospora phaffii sp.n.
Authors: van der Walt
Journal: A.v.Leeuwenhoek
Year: 1963
Title: Fabospora phaffii sp.n.
Authors: van der Walt
Journal: A.v.Leeuwenhoek
Year: 1963
DOI Number: 10.1016/S0378-1097(00)00450-X
Title: Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts
Authors: Buzzini, Martini
Journal: FEMS Microbiol.Lett.
Year: 2000
Title: Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts
Authors: Buzzini, Martini
Journal: FEMS Microbiol.Lett.
Year: 2000
DOI Number: 10.1016/S0723-2020(00)80077-6
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1111/j.1472-765X.2009.02754.x
Title: The zymocidial activity of Tetrapisispora phaffii in the control of Hanseniaspora uvarum during the early stages of winemaking
Authors: Comitini, Ciani
Journal: Lett.Appl.Microbiol.
Year: 2010
Title: The zymocidial activity of Tetrapisispora phaffii in the control of Hanseniaspora uvarum during the early stages of winemaking
Authors: Comitini, Ciani
Journal: Lett.Appl.Microbiol.
Year: 2010
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Request information
Insert your data to get information about this yeast