Taxon Name
Kluyveromyces wickerhamii (Phaff et al.) Van der Walt
Accession number
6077
Form of supply
agar slant
Synonymous
Dekkeromyces wickerhamii (Phaff et al.) Santa María & C. Sánchez, Guilliermondella wickerhamii (Phaff et al.) Boidin et al., Saccharomyces wickerhamii Phaff et al., Zygofabospora wickerhamii (Phaff et al.) Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24178; CBS 2745; IFO 1675; NCYC 908; NRRL Y-8286; UCD 54-210
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces wickerhamii Phaff et al.
Isolation source
gut of Drosophila sp., fruit fly
Isolation Locality
USA – United States of America
LSU (D1/D2)
GenBank U69577; Kluyveromyces_wickerhamii_DBVPG6077_D1D2
GCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAA
GGTAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAG
AATCCCGTGTGGCGAGGATCCCAGTTATATGTAAAGTGCTTTCGACGAGTCGAGTTGTTT
GGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACC
GATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAG
TACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCGTTC
GCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTAGCTCTACCTCGG
TAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCA
AGGATGCTGGCGTAATGGTTAAATGCCGCCCGTCTTGAA
18S rRNA
GenBank AY046263
ITS1&2
GenBank AY046212
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1007/BF02538322
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-49-4-1899
Title: Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea
Authors: Nagahama et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea
Authors: Nagahama et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Request information
Insert your data to get information about this yeast
