Taxon Name
Zygosaccharomyces bisporus Naganishi
Accession number
6103
Form of supply
agar slant
Synonymous
Saccharomyces bisporus (H. Naganishi) Lodder & Kreger-van Rij var. bisporus, Torulaspora bispora (Naganishi) Kocková-Kratochvílová
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 52405; CCRC 21505; CBS 702; CECT 11055; DBVPG 6382; IFO 1131; NCYC 1495; NRRL Y-7683; NRRL Y-7558; NRRL Y-12626; UCD 66-24
Risk Group
1
GMO
No
Status of the strain
Isotype of Zygosaccharomyces bisporus H. Naganishi
Received from
Miller – UCD, Davis, CA, USA
LSU (D1/D2)
GenBank U72162
18S rRNA
GenBank X91084
ITS1&2
GenBank AJ229176; Zygosaccharomyces_bisporus_DBVPG6103_ITS
TTTTTCGGCTCTTTCTTTTGCTTTTGGGCCTGCGCTTAGTTGCGCGGTCTAGAGTAGAGG
GAGCTTCTACTGCTTCGGCTTACAATTTACACACAGTGGAGTTTCTACTATTTTTCTTCT
TTAGGAGGATGATGAAAATCTATCTACTCCCAGAGGTAAACACAAACAATATTTTTATTT
TTTATTTTACACACAGTCAAATGAATACAAAAAAAAAATTATAATATTCAAAACTTTCAA
CAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTG
AATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCC
AGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACTTGTGTTTGGTAGTGAGTG
ATACTCTGTTAAAACTGGGTTAGCTTGAAATTGCAAGCCTTTTGGGGATGCGTCTAGAGA
AGAGTTTTAGGCGGAAACGTCTGGCTCCTCCTCTATTTTCCTTTAACCAAATGTCGTATT
AGGTTTTACCGACTCGGCAGACAGGTTGCTGGAGACTGAGGTGGGTGATAGAAATATCGA
ACTTTTCTGCGCGCCTTTGGCAAACAATACTCTCTAAGCTTGACCTCAAATCAGGTAGGA
TTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCT
TAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Goretti et al.. In vitro antimycotic activity of a Williopsis saturnus killer protein against food spoilage yeasts. Int.J.Food Microbiol. (2009), 131: 178-182 DOI: 10.1016/j.ijfoodmicro.2009.02.013
James et al.. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int.J.Syst.Bacteriol. (1996), 46: 189-194 DOI: 10.1099/00207713-46-1-189
Nakase, Komagata. SIGNIFICANCE OF DNA BASE COMPOSITION IN THE CLASSIFICATION OF YEAST GENUS SACCHAROMYCES. J.Gen.Appl.Microbiol. (1971), 17: 227-238 DOI: 10.2323/jgam.17.227
Tsuchiya et al.. Perfect form of Candida krusei. Jpn.J.Exp.Med. (1967), 37: 285-290
Goddard, Burt. Recurrent invasion and extinction of a selfish gene. Proc.Natl.Acad.Sci.US (2000), 96: 13880-13885 DOI: 10.1073/pnas.96.24.13880
James et al.. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small‐subunit rRNA gene sequences. Yeast (1994), 10: 871-881 DOI: 10.1002/yea.320100703
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Goretti et al.. In vitro antimycotic activity of a Williopsis saturnus killer protein against food spoilage yeasts. Int.J.Food Microbiol. (2009), 131: 178-182 DOI: 10.1016/j.ijfoodmicro.2009.02.013
James et al.. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int.J.Syst.Bacteriol. (1996), 46: 189-194 DOI: 10.1099/00207713-46-1-189
Nakase, Komagata. SIGNIFICANCE OF DNA BASE COMPOSITION IN THE CLASSIFICATION OF YEAST GENUS SACCHAROMYCES. J.Gen.Appl.Microbiol. (1971), 17: 227-238 DOI: 10.2323/jgam.17.227
Tsuchiya et al.. Perfect form of Candida krusei. Jpn.J.Exp.Med. (1967), 37: 285-290
Goddard, Burt. Recurrent invasion and extinction of a selfish gene. Proc.Natl.Acad.Sci.US (2000), 96: 13880-13885 DOI: 10.1073/pnas.96.24.13880
James et al.. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small‐subunit rRNA gene sequences. Yeast (1994), 10: 871-881 DOI: 10.1002/yea.320100703
Request information
Insert your data to get information about this yeast