Taxon Name
Kluyveromyces lactis (Dombrowski) Van der Walt var. drosophilarum (El-Tabey Shehata et al.) Siderburg & Lachance
Accession number
6112
Form of supply
agar slant
Synonymous
Dekkeromyces drosophilarum (El-Tabey Shehata et al.) Santa María & C. Sánchez, Dekkeromyces krasilnikovii (Kudryavtsev) E.K. Novák & Zsolt, Dekkeromyces phaseolosporus (El-Tabey Shehata et al.) Santa María & C. Sánchez, Dekkeromyces vanudenii (Van de
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24207; CCRC 22056; CBS 4372; IFO 1673; NRRL Y-6682; UCD 70-4
Risk Group
1
GMO
No
Status of the strain
Isotype of Kluyveromcyes vaudenii van der Walt & Nel
Isolation source
wine cellar
Isolation Locality
ZAF – South Africa
Received from
Marty Miller – USA – University of California – Davis
LSU (D1/D2)
GenBank D83467; Kluyveromyces_lactis_DBVPG6112_D1D2
AAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCAAC
TTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCC
GTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAAT
GCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGC
GAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTG
AAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGG
CCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGT
GTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATG
CTGGCGTAATGGTTAAATGCCGCCCGTCTTG
18S rRNA
GenBank D83433
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Saccharomyces vanudenii nov. spec.
Authors: van der Walt, Nel
Journal: Mycopathol.Mycol.Appl.
Year: 1963
Authors: van der Walt, Nel
Journal: Mycopathol.Mycol.Appl.
Year: 1963
DOI Number: 0.1007/BF01875545
Title: Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus
Authors: Vaughan-Martini et al.
Journal: Biotechnol.Tech.
Year: 1988
Title: Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus
Authors: Vaughan-Martini et al.
Journal: Biotechnol.Tech.
Year: 1988
DOI Number: 10.1016/S0723-2020(00)80077-6
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
DOI Number: 10.1099/00221287-140-6-1327
Title: Linear DNA plasmids from Pichia etchellsii, Debaryomyces hansenii and Wingea robertsiae
Authors: Cong et al.
Journal: Microbiology
Year: 1994
Title: Linear DNA plasmids from Pichia etchellsii, Debaryomyces hansenii and Wingea robertsiae
Authors: Cong et al.
Journal: Microbiology
Year: 1994
Request information
Insert your data to get information about this yeast
