Taxon Name
Danielia oregonensis (Phaff & Carmo Souza) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai
Accession number
6149
Form of supply
agar slant
Synonymous
Candida obtusa Dietrichson ex van Uden & H.R. Buckley var. oregonensis (Phaff & do Carmo Sousa) Montrocher; Candida oregonensis Phaff & do Carmo-Sousa
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 42268; CBS 5036; CCRC 21575; DSM 5784; IFO 1980; JCM 1811; NRRL Y-5850; UCD 60-73
Risk Group
1
GMO
No
Status of the strain
Isotype of Candida oregonensis Phaff & do Carmo-Sousa
Isolation source
frass of Tsuga heterophylla
Isolation Locality
USA – United States of America
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
04/02/1994
Collected by
LSU (D1/D2)
GenBank U44815; Danielia_oregonensis_DBVPG6149_D1D2 GCGGCAACGGCCCAAGTCCATTGGAACATGGCGCCAGGGAGGGTGAGAGCCCCGTCCGGCCACGCGCCGCGTCCGCAGTCTGCCCCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGCTTTTGCCGGGCCAGCATCGGTTTGGGGAGGCGGACAACCGCGGGAGCATGTGGCGCACCTCGGTGCGTGTTATAGCTCCCGTCCATACGCCTTCCCCAGTCCGAGGCCTGCGTTCTAAACTAGGATGCTGGCGTAATGGTTGCAAGCCGCC
18S rRNA
GenBank AB013545
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
DOI Number: 10.1007/BF02538734
Title: Four new species of yeast isolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent
Authors: Phaff, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962
DOI Number: 10.1016/j.biortech.2010.12.062
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
DOI Number: 10.1016/j.enzmictec.2009.09.004
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
DOI Number: 10.1016/S0723-2020(99)80030-7
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997

Request information

Insert your data to get information about this yeast

    Arrow Down
    Arrow Up