Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Saccharomyces cerevisiae Meyen ex E.C. Hansen var. cerevisiae
Accession number
6173
Form of supply
agar slant
Synonymous
Candida robusta Diddens & Lodder, Cryptococcus fermentans (Mrak & McClung) C.E. Skinner et al., Hormiscium cerevisiae Bail, Mycotorula robusta (Diddens & Lodder) Krasil\\\\\\\\\\\\\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18824; CBS 1171; CCRC 21447; DSM 70449; IFO 10217; IGC 4455; NCYC 505; NRRL Y-12632; CLIB 227; MUCL 31497; CECT 1942
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces cerevisiae Meyen ex E.C. Hansen
Isolation source
brewer
Isolation Locality
NLD – The Netherlands
Received from
Lennart Rodrigues de Miranda – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
22/05/1978
LSU (D1/D2)
GenBank U44806; Saccharomyces_cerevisiae_DBVPG6173_D1D2
AGCGGCAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAG
GGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAG
AATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTT
GGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACC
GATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAG
TACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGC
TCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGAT
AAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGC
TGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGT
CTT
18S rRNA
GenBank Z75578
ITS1&2
GenBank AB018043
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: DNA sequence polymorphisms in the genus saccharomyces III. Restriction endonuclease fragment patterns of chromosomal regions in brewing and other yeast strains
Authors: Pedersen
Journal: Carlsberg Res.Commun.
Year: 1986
Authors: Pedersen
Journal: Carlsberg Res.Commun.
Year: 1986
DOI Number: 10.1002/ptr.1622
Title: In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains
Authors: Turchetti et al.
Journal: Phytother.Res.
Year: 2005
Title: In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains
Authors: Turchetti et al.
Journal: Phytother.Res.
Year: 2005
DOI Number: 10.1007/BF01573968
Title: Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence
Authors: Kurtzman
Journal: J.Ind.Microbiol.
Year: 1995
Title: Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence
Authors: Kurtzman
Journal: J.Ind.Microbiol.
Year: 1995
DOI Number: 10.1016/j.bmcl.2008.05.048
Title: Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms
Authors: Buzzini et al.
Journal: Bioorg.Med.Chem.Lett.
Year: 2008
Title: Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms
Authors: Buzzini et al.
Journal: Bioorg.Med.Chem.Lett.
Year: 2008
DOI Number: 10.1016/j.jpba.2005.11.031
Title: Growth, lipid accumulation, and fatty acid composition in obligate psychrophilic, facultative psychrophilic, and mesophilic yeasts
Authors: Rossi et al.
Journal: J.Pharm.Biomed.Anal.
Year: 2009
Title: Growth, lipid accumulation, and fatty acid composition in obligate psychrophilic, facultative psychrophilic, and mesophilic yeasts
Authors: Rossi et al.
Journal: J.Pharm.Biomed.Anal.
Year: 2009
DOI Number: 10.1016/S0367-326X(03)00047-9
Title: Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms
Authors: Buzzini, Pieroni
Journal: Fitoterapia
Year: 2003
Title: Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms
Authors: Buzzini, Pieroni
Journal: Fitoterapia
Year: 2003
DOI Number: 10.1016/S0378-1097(00)00450-X
Title: Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts
Authors: Buzzini, Martini
Journal: FEMS Microbiol.Lett.
Year: 2000
Title: Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts
Authors: Buzzini, Martini
Journal: FEMS Microbiol.Lett.
Year: 2000
DOI Number: 10.1016/S0723-2020(11)80447-9
Title: The Significance of Active Fructose Transport and Maximum Temperature for Growth in the Taxonomy of Saccharomyces sensu stricto
Authors: Rodrigues de Sousa et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
Title: The Significance of Active Fructose Transport and Maximum Temperature for Growth in the Taxonomy of Saccharomyces sensu stricto
Authors: Rodrigues de Sousa et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
DOI Number: 10.1016/S0723-2020(89)80012-8
Title: Saccharomyces paradoxus comb. nov., a Newly Separated Species of the Saccharomyces sensu stricto Complex Based upon nDNA/nDNA Homologies
Authors: Vaughan-Martini
Journal: Syst.Appl.Microbiol.
Year: 1989
Title: Saccharomyces paradoxus comb. nov., a Newly Separated Species of the Saccharomyces sensu stricto Complex Based upon nDNA/nDNA Homologies
Authors: Vaughan-Martini
Journal: Syst.Appl.Microbiol.
Year: 1989
DOI Number: 10.1023/A:1018360029898
Title: Reduction of vanadate to vanadyl by a strain of Saccharomyces cerevisiae
Authors: Bisconti et al.
Journal: Biometals
Year: 1997
Title: Reduction of vanadate to vanadyl by a strain of Saccharomyces cerevisiae
Authors: Bisconti et al.
Journal: Biometals
Year: 1997
DOI Number: 10.1099/00207713-48-3-1015
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
DOI Number: 10.1111/j.1365-2672.2004.02247.x
Title: Assessment of discriminatory power of three different fingerprinting methods based on killer toxin sensitivity for the differentiation of Saccharomyces cerevisiae strains
Authors: Buzzini et al.
Journal: J.Appl.Microbiol.
Year: 2004
Title: Assessment of discriminatory power of three different fingerprinting methods based on killer toxin sensitivity for the differentiation of Saccharomyces cerevisiae strains
Authors: Buzzini et al.
Journal: J.Appl.Microbiol.
Year: 2004
DOI Number: 10.1111/j.1472-765X.1996.tb00071.x
Title: An Opportunity to distingush species of Saccharomyces Sensu stricto by electrophoretic separation of the larger Chromosomes
Authors: Tornai-Lehoczki, Dlauchy
Journal: Lett.Appl.Microbiol.
Year: 1996
Title: An Opportunity to distingush species of Saccharomyces Sensu stricto by electrophoretic separation of the larger Chromosomes
Authors: Tornai-Lehoczki, Dlauchy
Journal: Lett.Appl.Microbiol.
Year: 1996
DOI Number: 10.1139/w00-032
Title: Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest
Authors: Buzzini, Martini
Journal: Can.J.Microbiol.
Year: 2000
Title: Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest
Authors: Buzzini, Martini
Journal: Can.J.Microbiol.
Year: 2000
Request information
Insert your data to get information about this yeast