Taxon Name
Saccharomyces cerevisiae Meyen ex E.C. Hansen var. cerevisiae
Accession number
6173
Form of supply
agar slant
Synonymous
Candida robusta Diddens & Lodder, Cryptococcus fermentans (Mrak & McClung) C.E. Skinner et al., Hormiscium cerevisiae Bail, Mycotorula robusta (Diddens & Lodder) Krasil\\\\\\\\\\\\\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18824; CBS 1171; CCRC 21447; DSM 70449; IFO 10217; IGC 4455; NCYC 505; NRRL Y-12632; CLIB 227; MUCL 31497; CECT 1942
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces cerevisiae Meyen ex E.C. Hansen
Isolation source
brewer
Isolation Locality
NLD – The Netherlands
Received from
Rodrigues de Miranda – CBS, Delft, The Netherlands
Date of deposit
22/05/1978
LSU (D1/D2)
GenBank U44806; Saccharomyces_cerevisiae_DBVPG6173_D1D2
AGCGGCAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAG
GGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAG
AATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTT
GGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACC
GATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAG
TACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGC
TCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGAT
AAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGC
TGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGT
CTT
18S rRNA
GenBank Z75578
ITS1&2
GenBank AB018043
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Bisconti et al.. Reduction of vanadate to vanadyl by a strain of Saccharomyces cerevisiae. Biometals (1997), 10: 239-246 DOI: 10.1023/A:1018360029898
Buzzini et al.. Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms. Bioorg.Med.Chem.Lett (2008), 18: 3731-3733 DOI: 10.1016/j.bmcl.2008.05.048
Buzzini, Martini. Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest. Can.J.Microbiol. (2000), 46: 607-611 DOI: 10.1139/w00-032
Pedersen. Carlsberg Res.Commun. (1986), 51: 163-183
Buzzini, Martini. Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts. FEMS Microbiol.Lett. (2000), 193: 31-36 DOI: 10.1016/S0378-1097(00)00450-X
Buzzini, Pieroni. Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms. Fitoterapia (2003), 74: 397-400 DOI: 10.1016/S0367-326X(03)00047-9
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Buzzini et al.. Assessment of discriminatory power of three different fingerprinting methods based on killer toxin sensitivity for the differentiation of Saccharomyces cerevisiae strains. J.Appl.Microbiol. (2004), 96: 1194-1201 DOI: 10.1111/j.1365-2672.2004.02247.x
Kurtzman. Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence. J.Ind.Microbiol. (1995), 14: 523-530 DOI: 10.1007/BF01573968
Romani et al.. Analysis of condensed and hydrolysable tannins from commercial plant extracts. J.Pharm.Biomed.Anal. (2006), 41: 415-420 DOI: 10.1016/j.jpba.2005.11.031
Tornai-Lehoczki, Dlauchy. Lett.Appl.Microbiol. (1996), 23: 227-230
Turchetti et al.. In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains. Phytother.Res. (2005), 19: 44-49 DOI: 10.1002/ptr.1622
Vaughan-Martini. Saccharomyces paradoxus comb. nov., a Newly Separated Species of the Saccharomyces sensu stricto Complex Based upon nDNA/nDNA Homologies. Syst.Appl.Microbiol. (1989), 12: 179-182 DOI: 10.1016/S0723-2020(89)80012-8
Rodrigues de Sousa et al.. The Significance of Active Fructose Transport and Maximum Temperature for Growth in the Taxonomy of Saccharomyces sensu stricto. Syst.Appl.Microbiol. (1995), 18: 44-51 DOI: 10.1016/S0723-2020(11)80447-9
Buzzini et al.. Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms. Bioorg.Med.Chem.Lett (2008), 18: 3731-3733 DOI: 10.1016/j.bmcl.2008.05.048
Buzzini, Martini. Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest. Can.J.Microbiol. (2000), 46: 607-611 DOI: 10.1139/w00-032
Pedersen. Carlsberg Res.Commun. (1986), 51: 163-183
Buzzini, Martini. Differential growth inhibition as a tool to increase the discriminating power of killer toxin sensitivity in fingerprinting of yeasts. FEMS Microbiol.Lett. (2000), 193: 31-36 DOI: 10.1016/S0378-1097(00)00450-X
Buzzini, Pieroni. Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms. Fitoterapia (2003), 74: 397-400 DOI: 10.1016/S0367-326X(03)00047-9
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Buzzini et al.. Assessment of discriminatory power of three different fingerprinting methods based on killer toxin sensitivity for the differentiation of Saccharomyces cerevisiae strains. J.Appl.Microbiol. (2004), 96: 1194-1201 DOI: 10.1111/j.1365-2672.2004.02247.x
Kurtzman. Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence. J.Ind.Microbiol. (1995), 14: 523-530 DOI: 10.1007/BF01573968
Romani et al.. Analysis of condensed and hydrolysable tannins from commercial plant extracts. J.Pharm.Biomed.Anal. (2006), 41: 415-420 DOI: 10.1016/j.jpba.2005.11.031
Tornai-Lehoczki, Dlauchy. Lett.Appl.Microbiol. (1996), 23: 227-230
Turchetti et al.. In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains. Phytother.Res. (2005), 19: 44-49 DOI: 10.1002/ptr.1622
Vaughan-Martini. Saccharomyces paradoxus comb. nov., a Newly Separated Species of the Saccharomyces sensu stricto Complex Based upon nDNA/nDNA Homologies. Syst.Appl.Microbiol. (1989), 12: 179-182 DOI: 10.1016/S0723-2020(89)80012-8
Rodrigues de Sousa et al.. The Significance of Active Fructose Transport and Maximum Temperature for Growth in the Taxonomy of Saccharomyces sensu stricto. Syst.Appl.Microbiol. (1995), 18: 44-51 DOI: 10.1016/S0723-2020(11)80447-9
Request information
Insert your data to get information about this yeast