Taxon Name
Lachancea kluyveri (Phaff, M.W. Miller & Shiffrine) Kurtzman
Accession number
6177
Form of supply
agar slant
Synonymous
Saccharomyces kluyveri Phaff et al., Torulaspora kluyveri (Phaff et al.) Kocková-Kratochvílová, Saccharomyces silvestris Jensen, Saccharomyces smittii Capriotti
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58438; CCRC 21498; CBS 3082; IFO 1685; JCM 7257; NCYC 543; NRRL Y-12651; UCD 51-242
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces kluyveri Phaff et al.
Isolation source
Drosophila pinicola, fruit fly
Received from
Lennart Rodrigues de Miranda – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
22/05/1978
LSU (D1/D2)
GenBank U68552; Lachancea_kluyveri_DBVPG6177_D1D2 GAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTTGGTGTCCGAGTTGTAATTTGAA
GAAGTAACTTTGGGGCTGATCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTG
AGAATCCCGTGTGGCGAGGAATTCAGTCCTATGTAAAGTGCTTTCGACGAGTCGAGTTGT
TTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGA
CCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAA
AGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTA
GCTCCTTGTGGGTTGGGATCTCGCAGCTCACTGGGCCAACATCAGTTTTGGCGGTGGGAT
AAATCCTTAGGAATGTGGCTTGTCTTCGGAGAAGTGTTATAGCCTAGGGGAATACCGCCA
GCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTAAATGCCGCCC
GTCTTG
18S rRNA
GenBank Z75580
ITS1&2
GenBank AY046209
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1007/BF02538322
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
DOI Number: 10.1016/S0723-2020(11)80239-0
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
DOI Number: 10.1016/S0723-2020(11)80456-X
Title: Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii
Authors: Naumov et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
Title: Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii
Authors: Naumov et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1099/00207713-35-4-508
Title: Deoxyribonucleic Acid Relatedness among Species of the Genus Saccharomyces Sensu Stricto
Authors: Vaughan-Martini, Kurtzman
Journal: Int.J.Syst.Bacteriol.
Year: 1985
Title: Deoxyribonucleic Acid Relatedness among Species of the Genus Saccharomyces Sensu Stricto
Authors: Vaughan-Martini, Kurtzman
Journal: Int.J.Syst.Bacteriol.
Year: 1985
DOI Number: 10.1099/00207713-47-2-453
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
DOI Number: 10.1099/00207713-48-3-1015
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
DOI Number: 10.1099/00207713-51-4-1593
Title: Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs
Authors: Daniel et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
Title: Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs
Authors: Daniel et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
DOI Number: 10.1126/science.1084337
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
DOI Number: 10.1128/JCM.42.12.5624-5635.2004
Title: Phylogeny and evolution of medical species of candida and related taxa: A multigenic analysis
Authors: Diezmann et al.
Journal: J.Clin.Microbiol.
Year: 2004
Title: Phylogeny and evolution of medical species of candida and related taxa: A multigenic analysis
Authors: Diezmann et al.
Journal: J.Clin.Microbiol.
Year: 2004
Request information
Insert your data to get information about this yeast
