Taxon Name
Lipomyces starkeyi Lodder & Kreger-van Rij
Accession number
6193
Form of supply
Agar
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 1807; CCRC 21522; DBVPG 6776; IFO 1289; IFO 10381; JCM 5995; MUCL 39418; NRRL Y-1388; UCD 51-55
Risk Group
1
GMO
No
Status of the strain
Isotype of Lipomyces starkeyi Lodder & Kreger-van Rij
Isolation source
soil
Isolation Locality
USA – United States of America
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
04/02/1994
LSU (D1/D2)
GenBank U45824; Lipomyces_starkeyi_DBVPG6193_D1D2
AGAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGTAGAAGCATCT
TTTGGATTGGTCCTTGCATATGTTCCTTGGAACAGGACATCATAGAGGGTGAGAATCCCG
TTCATGGTGGGGAATCCAATTCTTTGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAA
TGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAG
CGAACAAGTACAGTGATGGAAAGATGAAAAGAACTCCGAAAGGAGAGTGAAAAAGGACGT
GAAATTGTTGAAAGGGAAGTGCTTGAGATCAGTCTTAAGGTTTAGTGATCAGTCTTCCTT
TTGGTTGGTGCACTCACTATTTCTTAGGCCAACATCAGTTTTGGCGGCAGGATAATGACA
TTGGAATGTGGCTCTTTCGGGAGTGTTATAGCCTTTGTTGATACTGCCTGCTTAGACTGA
GGACTGCGCTTTTGCTAGGATGTTGGCATAATGATCTTAAGCAGCCCGTCTTG
ITS1&2
GenBank U82459
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: The coenzyme Q system in strains of species in the ascosporogenous yeast genera Lipomyces and Waltomyces
Authors: Yamada et al.
Journal: Trans.Mycol.Soc.Japan
Year: 1986
Authors: Yamada et al.
Journal: Trans.Mycol.Soc.Japan
Year: 1986
DOI Number: 10.1007/BF00873295
Title: Species delimitation in the genus Lipomyces by nuclear genome comparison
Authors: Smith et al.
Journal: A.v.Leeuwenhoek
Year: 1995
Title: Species delimitation in the genus Lipomyces by nuclear genome comparison
Authors: Smith et al.
Journal: A.v.Leeuwenhoek
Year: 1995
DOI Number: 10.1023/A:1000297311089
Title: Lipomyces mesembrius sp. nov., a member of the L. starkeyi species-complex
Authors: van der Walt et al.
Journal: A.v.Leeuwenhoek
Year: 1997
Title: Lipomyces mesembrius sp. nov., a member of the L. starkeyi species-complex
Authors: van der Walt et al.
Journal: A.v.Leeuwenhoek
Year: 1997
DOI Number: 10.1023/A:1001740812593
Title: Diversity and affinities among species and strains of Lipomyces
Authors: Gouliamova et al.
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Diversity and affinities among species and strains of Lipomyces
Authors: Gouliamova et al.
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00221287-127-1-169
Title: Correlation of Lipid Accumulation in Yeasts with Possession of ATP: Citrate Lyase
Authors: Boulton, Ratledge
Journal: J.Gen.Microbiol.
Year: 1981
Title: Correlation of Lipid Accumulation in Yeasts with Possession of ATP: Citrate Lyase
Authors: Boulton, Ratledge
Journal: J.Gen.Microbiol.
Year: 1981
DOI Number: 10.1099/13500872-42-3-381
Title: Extracellular Polysaccharides and Classification of the Genus Lipomyces
Authors: Slodki, Wickerham
Journal: J.Gen.Microbiol.
Year: 1966
Title: Extracellular Polysaccharides and Classification of the Genus Lipomyces
Authors: Slodki, Wickerham
Journal: J.Gen.Microbiol.
Year: 1966
DOI Number: 10.1128/jb.51.1.33-50.1946
Title: Lipid Production by a Soil Yeast
Authors: Starkey
Journal: J.Bacteriol.
Year: 1946
Title: Lipid Production by a Soil Yeast
Authors: Starkey
Journal: J.Bacteriol.
Year: 1946
Request information
Insert your data to get information about this yeast
