Taxon Name
Lachancea waltii (K. Kodama) Kurtzman
Accession number
6233
Form of supply
agar slant
Synonymous
Kluyveromyces waltii K. Kodama, Zygofabospora waltii (K. Kodama) Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 56500; CCRC 22066; CBS 6430; IFO 1666; NCYC 2644; NRRL Y-8285; UCD 72-13
Risk Group
1
GMO
No
Status of the strain
Isotype of Kluyveromyces waltii Kodama
Isolation source
exudate of Ilex integra
Isolation Locality
JPN – Japan
Received from
Rodrigues de Miranda – CBS, Delft, The Netherlands
Date of deposit
20/10/1983
LSU (D1/D2)
GenBank U69582; Lachancea_waltii_DBVPG6233_D1D2 ACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGTCACCTTCGGTGTCCGAGTTG
TAATTTGAAGAAGCTACTTTGGGGCTAGTCCTTGTCTATGTTCCTTGGAACAGGACGTCA
TGGAGGGTGAGAATCCCGTATGGCGAGGAGCCTAGTCCTATGTAAAGTGCTTTCGACGAG
TCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATT
GGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGA
GAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTT
GCGACCCTTACTCCTTGTGGGTGAGGATCTCGCAGCTCACTGGGCCAACATCAGTTTTGG
CGGCAGGATAAATCTTTGGGAATGTGGCTTGTCTTCGGAGAAGCGTTATAGCCCAGGGGA
ATACTGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTAT
ATGCCGCCCGTC
18S rRNA
GenBank X89527
ITS1&2
GenBank AY046208
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Kodama, Kyono. Ascosporogenous yeasts isolated from tree exudates in Japan. J.Ferment.Technol. (1974), 52: 605-613
Chen et al.. Characterization of a circular plasmid from the yeast Kluyveromyces waltii. J.Gen.Microbiol. (1992), 138: 337-345 DOI: 10.1099/00221287-138-2-337
Kellis et al.. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature (2004), 428: 617-624 DOI: 10.1038/nature01644
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Kodama, Kyono. Ascosporogenous yeasts isolated from tree exudates in Japan. J.Ferment.Technol. (1974), 52: 605-613
Chen et al.. Characterization of a circular plasmid from the yeast Kluyveromyces waltii. J.Gen.Microbiol. (1992), 138: 337-345 DOI: 10.1099/00221287-138-2-337
Kellis et al.. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature (2004), 428: 617-624 DOI: 10.1038/nature01644
Request information
Insert your data to get information about this yeast