Taxon Name
Lachancea waltii (K. Kodama) Kurtzman
Accession number
6233
Form of supply
agar slant
Synonymous
Kluyveromyces waltii K. Kodama, Zygofabospora waltii (K. Kodama) Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 56500; CCRC 22066; CBS 6430; IFO 1666; NCYC 2644; NRRL Y-8285; UCD 72-13
Risk Group
1
GMO
No
Status of the strain
Isotype of Kluyveromyces waltii Kodama
Isolation source
exudate of Ilex integra
Isolation Locality
JPN – Japan
Received from
Lennart Rodrigues de Miranda – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
20/10/1983
LSU (D1/D2)
GenBank U69582; Lachancea_waltii_DBVPG6233_D1D2 ACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGTCACCTTCGGTGTCCGAGTTG
TAATTTGAAGAAGCTACTTTGGGGCTAGTCCTTGTCTATGTTCCTTGGAACAGGACGTCA
TGGAGGGTGAGAATCCCGTATGGCGAGGAGCCTAGTCCTATGTAAAGTGCTTTCGACGAG
TCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATT
GGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGA
GAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTT
GCGACCCTTACTCCTTGTGGGTGAGGATCTCGCAGCTCACTGGGCCAACATCAGTTTTGG
CGGCAGGATAAATCTTTGGGAATGTGGCTTGTCTTCGGAGAAGCGTTATAGCCCAGGGGA
ATACTGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTAT
ATGCCGCCCGTC
18S rRNA
GenBank X89527
ITS1&2
GenBank AY046208
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Ascosporogenous yeasts isolated from tree exudates in Japan
Authors: Kodama, Kyono
Journal: J.Ferment.Technol.
Year: 1974
Authors: Kodama, Kyono
Journal: J.Ferment.Technol.
Year: 1974
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1038/nature01644
Title: Sequencing and comparison of yeast species to identify genes and regulatory elements
Authors: Kellis et al.
Journal: Nature
Year: 2004
Title: Sequencing and comparison of yeast species to identify genes and regulatory elements
Authors: Kellis et al.
Journal: Nature
Year: 2004
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1099/00207713-49-1-319
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
DOI Number: 10.1099/00221287-138-2-337
Title: Characterization of a circular plasmid from the yeast Kluyveromyces waltii
Authors: Chen et al.
Journal: J.Gen.Microbiol.
Year: 1992
Title: Characterization of a circular plasmid from the yeast Kluyveromyces waltii
Authors: Chen et al.
Journal: J.Gen.Microbiol.
Year: 1992
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Request information
Insert your data to get information about this yeast
