Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Solicoccozyma aeria (Saito) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6237
Form of supply
agar slant
Synonymous
Cryptococcus aerius (Saito) Nann., Torula aeria Saito, Torulopsis aeria (Saito) Lodder var. aeria, Paratorulopsis aeria (Saito) Novak & Szolt, Cryptococcus albidus (Saito) C.E. Skinner var. aerius (Saito) Phaff & Fell
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 32039; CBS 4192; MUCL 30595; NRRL Y-2565
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis pseudoaeria Zsolt
Isolation source
soil of vineyard
Isolation Locality
HUN – Hungary
Received from
Lennart Rodrigues de Miranda – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
11/03/1983
LSU (D1/D2)
GenBank AF181544; Solicoccozyma_aeria_DBVPG6237_D1D2
AATTTGAAATCTGGCAGCCTCAGGTTGTCCGAGTTGTAATCTATAGAAACGTTTTCCGCG
CTGGCCCATGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTG
ACACGGACCACCAGTGCTTTGTGATACGTTTTCAACGAGTCGAGTTGTTTGGGAATGCAG
CTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC
AAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAAT
TGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGACTCAGCCGGTTCTGCCGGT
GTACTTCCTTTAGATGGGGTCAACATCAGTTTTGATCGCTGGAAAAGGGCGGGAGGAATG
TAGCACTCTCGGGTGAACTTATAGCCTTCCGTCGTATACAGTGGTTGGGACTGAGGAACG
CAGCATGCCTTTATGGCCGGGGTTCGCCCACGTACATGCTTAGGATGTTGACATAATGGC
TTTAAACGACCCGTCT
18S rRNA
GenBank AF444376
ITS1&2
GenBank AF444376
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1007/BF02548447
Title: Torulopsis pseudaeria nov. spec., A new yeast from soil
Authors: Zsolt
Journal: A.v.Leeuwenhoek
Year: 1958
Title: Torulopsis pseudaeria nov. spec., A new yeast from soil
Authors: Zsolt
Journal: A.v.Leeuwenhoek
Year: 1958
DOI Number: 10.1016/0147-5975(91)90014-5
Title: Intraspecific discontinuity within the yeast species Cryptococcus albidus as revealed by nDNA/nDNAreassociation
Authors: Vaughan-Martini
Journal: Exptl.Mycol.
Year: 1991
Title: Intraspecific discontinuity within the yeast species Cryptococcus albidus as revealed by nDNA/nDNAreassociation
Authors: Vaughan-Martini
Journal: Exptl.Mycol.
Year: 1991
DOI Number: 10.1016/j.biortech.2010.12.062
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
DOI Number: 10.1016/j.enzmictec.2009.09.004
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1016/S1567-1356(02)00128-9
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
Request information
Insert your data to get information about this yeast