Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Papiliotrema laurentii (Kuff.) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6265
Form of supply
agar slant
Synonymous
Cryptococcus laurentii (Kufferath) C.E. Skinner, Rhodotorula laurentii (Kufferath) T. Hasegawa et al., Torula laurentii Kufferath, Torulopsis laurentii (Kufferath) Lodder, Rhodotorula flavescens (Saito) Krassil\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18803; CBS 139; CCRC 20527; IGC 3966; IFO 0609; MUCL 30398; NRRL Y-2536; VKM Y-1665; VKPM Y 219; JCM 9066; UCD 68-201; DBVPG 6640
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula laurentii Kufferath
Isolation source
palm wine
Isolation Locality
COG – Congo
Received from
CBS, Delft, The Netherlands
Date of deposit
10/01/1984
LSU (D1/D2)
GenBank AF075469; Papiliotrema_laurentii_DBVPG6265_D1D2
AAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGT
GCCGGACCGTGTCCAAGTTCCTTGGAACAGGATATCAAAGAGGGTGACAATCCCGTACTT
GACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAG
CTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC
AAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT
TGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGT
GTATTCCCCTCGGTCGGGTCAACATCAGTTTTGTCCGGTGGATAAGGACGGTAGGAAGGT
GGCACCCTCGGGTGTGTTATAGCCTGCCGTCGCATACATCGGGTGAGACTGAGGAACGCA
GCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTT
TAAACGACCCGTCTTGA
18S rRNA
GenBank AB032640
ITS1&2
GenBank AF410468
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Kufferath. Ann.Bull.Soc.Séances Soc.R.Sci.Méd.Nat.Bruxelles (1920), 74: 16-46
Buzzini et al.. Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms. Bioorg.Med.Chem.Lett (2008), 18: 3731-3733 DOI: 10.1016/j.bmcl.2008.05.048
Buzzini, Martini. Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest. Can.J.Microbiol. (2000), 46: 607-611 DOI: 10.1139/w00-032
Lee et al.. Phylogenetic analysis of Xylaria based on nuclear ribosomal ITS1-5.8S-ITS2 sequences. FEMS Microbiol.Lett. (2000), 187: 89-93 DOI: 10.1111/j.1574-6968.2000.tb09142.x
Buzzini, Pieroni. Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms. Fitoterapia (2003), 74: 397-400 DOI: 10.1016/S0367-326X(03)00047-9
Butler, Poulter. A cluster of NIF transcriptional regulators with divergent patterns of spore-specific expression in Phytophthora infestans. Fungal.Genet.Biol. (2005), 42: 452-463 DOI: 10.1016/j.fgb.2004.09.005
Fell et al.. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int.J.Syst.Bacteriol. (1999), 49: 907-913 DOI: 10.1099/00207713-49-2-907
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Romani et al.. Analysis of condensed and hydrolysable tannins from commercial plant extracts. J.Pharm.Biomed.Anal. (2006), 41: 415-420 DOI: 10.1016/j.jpba.2005.11.031
Turchetti et al.. In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains. Phytother.Res. (2005), 19: 44-49 DOI: 10.1002/ptr.1622
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Buzzini et al.. Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms. Bioorg.Med.Chem.Lett (2008), 18: 3731-3733 DOI: 10.1016/j.bmcl.2008.05.048
Buzzini, Martini. Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest. Can.J.Microbiol. (2000), 46: 607-611 DOI: 10.1139/w00-032
Lee et al.. Phylogenetic analysis of Xylaria based on nuclear ribosomal ITS1-5.8S-ITS2 sequences. FEMS Microbiol.Lett. (2000), 187: 89-93 DOI: 10.1111/j.1574-6968.2000.tb09142.x
Buzzini, Pieroni. Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms. Fitoterapia (2003), 74: 397-400 DOI: 10.1016/S0367-326X(03)00047-9
Butler, Poulter. A cluster of NIF transcriptional regulators with divergent patterns of spore-specific expression in Phytophthora infestans. Fungal.Genet.Biol. (2005), 42: 452-463 DOI: 10.1016/j.fgb.2004.09.005
Fell et al.. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int.J.Syst.Bacteriol. (1999), 49: 907-913 DOI: 10.1099/00207713-49-2-907
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Romani et al.. Analysis of condensed and hydrolysable tannins from commercial plant extracts. J.Pharm.Biomed.Anal. (2006), 41: 415-420 DOI: 10.1016/j.jpba.2005.11.031
Turchetti et al.. In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains. Phytother.Res. (2005), 19: 44-49 DOI: 10.1002/ptr.1622
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Request information
Insert your data to get information about this yeast