Taxon Name
Sungouiella intermedia (Cif. & Ashford) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai
Accession number
6286
Form of supply
agar slant
Synonymous
Blastodendrion intermedium Ciferri & Ashford, Cryptococcus intermedius (Ciferri & Ashford) Nannizzi, Mycotorula intermedia (Ciferri & Ashford) Krasil
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 7153; IFO 10601; NRRL Y-12509
Risk Group
1
GMO
No
Isolation Locality
USA – United States of America
Received from
Smith – CBS, Delft, The Netherlands
Date of deposit
17/02/1986
LSU (D1/D2)
GenBank AJ508588; Sungouiella_intermedia_DBVPG6286_D1D2 AACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGGTTGGGAGACCCCGCGGCTAGTGGCACCAAGTCCCTTGGAACAGGGCGCCTTAGAGGGTGAGAGCCCCGTAGGTACCACAATACCGTCTTGTGTCTCCTCTCCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGCCTTCGTGCCGGGCCAGCATCGGTTGCTAGGGGTGGATAAGGAACAAGGAATGTAGCTCCTCGGAGTATTATAGCCTTGCGCGATACACCCACTGGCGACCGAGGCCTGCGGTATTCTTTACCTAGGATGCTGGCGTAATGGTTGCAAGCCGCCCGTCTTGAACACGGACC
18S rRNA
GenBank X89518
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Martini, Vaughan-Martini. Assignment of Kluyveromyces cellobiovorus nomen nudum to Candida intermedia (Ciferri & Ashford) Langeron et Guerra. A.v.Leeuwenhoek (1992), 61: 57-60 DOI: 10.1007/BF00572123
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Request information
Insert your data to get information about this yeast