Taxon Name
Lachancea fermentati (H. Naganishi) Kurtzman
Accession number
6297
Form of supply
agar slant
Synonymous
Saccharomyces montanus Phaff et al., Torulaspora montana (Phaff et al.) Kocková-KratochvÃlová, Zygosaccharomyces fermentati H. Naganishi, Debaryomyces manchuricus H. Naganishi, Saccharomyces albasitensis Santa MarÃa, Saccharomyces amurcae Van der Walt
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58446; CBS 707; CCRC 21760; IFO 0479; NRRL Y-1559; CECT 11056
Risk Group
1
GMO
No
Status of the strain
Isotype of Zygosaccharomyces fermentati H. Naganishi; Isotype of Saccharomyces montanus Phaff et al.
Isolation source
sedimeEx-type of peppermiEx-type
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
15/08/1986
LSU (D1/D2)
GenBank U84239; Lachancea_fermentati_DBVPG6297_D1D2 GCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAA
GCAACTTTGGTGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGA
ATCCCGTGTGGCGAGGATCCCAGTGCTATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTG
GGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCG
ATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGT
ACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTCGCT
CCTTGTGGGTGGGGATCTCGCAGCTCACTGGGCCAACATCGGTTTTGGCGGCAGGATAAA
ACTTTGGGAATGTAGCTTGTCTTCGGAGAAGTATTATAGCCCAAGGCAATACTGCCAGCC
GGGACCGAGGACTGCGACTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGCCCGTCT
TGAACCACGGACC
18S rRNA
GenBank X77930
ITS1&2
GenBank AY046206
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/yea.320060306
Title: DNA relatedness among species of the genus Zygosaccharomyces
Authors: Kurtzman
Journal: Yeast
Year: 1990
Title: DNA relatedness among species of the genus Zygosaccharomyces
Authors: Kurtzman
Journal: Yeast
Year: 1990
DOI Number: 10.1002/yea.320100605
Title: Characterization of MEL genes in the genus Zygosaccharomyces
Authors: Turakainen et al.
Journal: Yeast
Year: 1994
Title: Characterization of MEL genes in the genus Zygosaccharomyces
Authors: Turakainen et al.
Journal: Yeast
Year: 1994
DOI Number: 10.1002/yea.320100703
Title: Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small�subunit rRNA gene sequences
Authors: James et al.
Journal: Yeast
Year: 1994
Title: Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small�subunit rRNA gene sequences
Authors: James et al.
Journal: Yeast
Year: 1994
DOI Number: 10.1007/BF02538322
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
Title: The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California
Authors: Phaff et al.
Journal: A.v.Leeuwenhoek
Year: 1956
DOI Number: 10.1016/S0723-2020(00)80077-6
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-46-1-189
Title: Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1099/00207713-47-2-453
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
DOI Number: 10.1099/00207713-49-1-319
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Request information
Insert your data to get information about this yeast
