Taxon Name
Kluyveromyces aestuarii (Fell) Van der Walt
Accession number
6307
Form of supply
agar slant
Synonymous
Dekkeromyces aestuarii (Fell) Kocková-Kratochv¡lová, Saccharomyces aestuarii Fell, Zygofabospora aestuarii (Fell) G.I. Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18862; CBS 4438; CCRC 22014; IFO 10597; NRRL Y-4510; UCD 61-29
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces aestuarii Fell
Isolation source
mud of estuary
Isolation Locality
USA – United States of America
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
04/02/1994
LSU (D1/D2)
GenBank U69579; Kluyveromyces_aestuarii_DBVPG6307_D1D2
GGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGGCGTCCGAGTTGTA
ATTTGAAGAAGGCTACTTTGGGTCTGGTCCTTATCTATGTTCCTTGGAACAGGACGTCAT
AGAGGGTGAGAATCCCGTGTGATGAGGATCCCAGTCCTATGTAAAGTGCTTTCGACGAGT
CGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTG
GCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAG
AGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGC
TTCGGCTTTCGCTGGGCCAGCATCAGTTTTGGCGGTTGGATAAATCCTCGGGAATGTGGC
TCTACTTGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGACTGCGAC
TTTTAGTCAAGGATGCTGGCGTAATGGTTATATGCCGCCCGTCTT
18S rRNA
GenBank X89520
ITS1&2
GenBank AY046210
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1007/BF02538419
Title: A new species of Saccharomyces isolated from a subtropical estuary
Authors: Fell
Journal: A.v.Leeuwenhoek
Year: 1961
Title: A new species of Saccharomyces isolated from a subtropical estuary
Authors: Fell
Journal: A.v.Leeuwenhoek
Year: 1961
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-43-1-115
Title: Kluyveromyces bacillisporus sp. nov., a yeast from Emory oak exudate
Authors: Lachance et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1993
Title: Kluyveromyces bacillisporus sp. nov., a yeast from Emory oak exudate
Authors: Lachance et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1993
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1099/00207713-47-2-453
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
DOI Number: 10.1099/00207713-49-4-1899
Title: Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea
Authors: Nagahama et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea
Authors: Nagahama et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
DOI Number: 10.2323/jgam.44.399
Title: Restriction analysis of the ITS region for characterization of the Debaryomyces species
Authors: Ramos et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1998
Title: Restriction analysis of the ITS region for characterization of the Debaryomyces species
Authors: Ramos et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1998
Request information
Insert your data to get information about this yeast
