Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Kluyveromyces aestuarii (Fell) Van der Walt
Accession number
6307
Form of supply
agar slant
Synonymous
Dekkeromyces aestuarii (Fell) Kocková-Kratochv¡lová, Saccharomyces aestuarii Fell, Zygofabospora aestuarii (Fell) G.I. Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18862; CBS 4438; CCRC 22014; IFO 10597; NRRL Y-4510; UCD 61-29
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces aestuarii Fell
Isolation source
mud of estuary
Isolation Locality
USA – United States of America
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
04/02/1994
LSU (D1/D2)
GenBank U69579; Kluyveromyces_aestuarii_DBVPG6307_D1D2
GGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGGCGTCCGAGTTGTA
ATTTGAAGAAGGCTACTTTGGGTCTGGTCCTTATCTATGTTCCTTGGAACAGGACGTCAT
AGAGGGTGAGAATCCCGTGTGATGAGGATCCCAGTCCTATGTAAAGTGCTTTCGACGAGT
CGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTG
GCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAG
AGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGC
TTCGGCTTTCGCTGGGCCAGCATCAGTTTTGGCGGTTGGATAAATCCTCGGGAATGTGGC
TCTACTTGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGACTGCGAC
TTTTAGTCAAGGATGCTGGCGTAATGGTTATATGCCGCCCGTCTT
18S rRNA
GenBank X89520
ITS1&2
GenBank AY046210
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Fell. A new species of Saccharomyces isolated from a subtropical estuary. A.v.Leeuwenhoek (1961), 27: 27-30 DOI: 10.1007/BF02538419
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Fiol. Annales de l\’Institut Pasteur (1970), 118: 697-708
Fiol, Poncet. Annales de l\’Institut Pasteur (1971), 121: 75-85
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Lachance et al.. Kluyveromyces bacillisporus sp. nov., a yeast from Emory oak exudate. Int.J.Syst.Bacteriol. (1993), 43: 115-119 DOI: 10.1099/00207713-43-1-115
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Nagahama et al.. Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea. Int.J.Syst.Bacteriol. (1999), 49: 1899-1905 DOI: 10.1099/00207713-49-4-1899
Ramos et al.. Restriction analysis of the ITS region for characterization of the Debaryomyces species. J.Gen.Appl.Microbiol. (1998), 44: 399-404 DOI: 10.2323/jgam.44.399
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Fiol. Annales de l\’Institut Pasteur (1970), 118: 697-708
Fiol, Poncet. Annales de l\’Institut Pasteur (1971), 121: 75-85
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Lachance et al.. Kluyveromyces bacillisporus sp. nov., a yeast from Emory oak exudate. Int.J.Syst.Bacteriol. (1993), 43: 115-119 DOI: 10.1099/00207713-43-1-115
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Nagahama et al.. Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea. Int.J.Syst.Bacteriol. (1999), 49: 1899-1905 DOI: 10.1099/00207713-49-4-1899
Ramos et al.. Restriction analysis of the ITS region for characterization of the Debaryomyces species. J.Gen.Appl.Microbiol. (1998), 44: 399-404 DOI: 10.2323/jgam.44.399
Request information
Insert your data to get information about this yeast