Share
Facebook
Linkedin
Twitter
PrintTaxon Name
Jamesozyma lodderae (van der Walt & Tscheuschner) Q.M. Wang, Yurkov & Boekhout
Accession number
6308
Form of supply
agar slant
Synonymous
Kazachstania lodderae (van der Walt & Tscheuschner) Kurtzman, Dekkeromyces lodderae (Van der Walt & Tscheuschner) E.K. Novák & Zsolt, Guilliermondella lodderae (Van der Walt & Tscheuschner) Boidin et al., Kluyveromyces lodderae (Van der Walt & Tscheuschner) Van der Walt, Saccharomyces lodderae Van der Walt & Tscheuschner, Zygofabospora lodderae (Van der Walt et Tscheuschner) Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24206; CBS 2757; CCRC 22117; IFO 10606; NCYC 1417; NRRL Y-8280; UCD 70-3
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces lodderae Van der Walt & Tscheuschner
Isolation source
soil
Isolation Locality
ZAF – South Africa
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
20/03/1987
LSU (D1/D2)
GenBank U68551; Jamesozyma_lodderae_DBVPG6308_D1D2
AGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTCGGTGCTCGAGTTGTAATTTGTAGA
GGGATACTTTGGGGCCGTTCCTTATCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGA
GAATCCCGTATGATGAGGAGTGCGGTTCTATGTAAAGTGCTCTCGAAGAGTCGAGTTGTT
TGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAC
CGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAA
GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTG
CTCCTTGTGGGTGGGGGACTCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGA
TAAATCTGTAGGAATGTAGCTTGCTTCGGGAAGTGTTATAGCCTGCGGGAATACTGCCAG
CTGGGATTGAGGACTGCGACATTCGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCG
TC
18S rRNA
GenBank X83824
ITS1&2
GenBank AY046160
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
van der Walt, Tscheuschner. Three new yeasts. A.v.Leeuwenhoek (1957), 23: 184-190 DOI: 10.1007/BF02545868
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Raimondi et al.. Rapid method for screening enoate reductase activity in yeasts. J.Microbiol.Methods (2010), 83: 106-110 DOI: 10.1016/j.mimet.2010.09.007
Forzato et al.. Chemoenzymatic and yeast-catalysed synthesis of diastereomeric ethyl c-phenyl and c-(n-pyridyl)paraconates. Tetrahedron Asimmetry (2008), 19: 2026-2036 DOI: 10.1016/j.tetasy.2008.08.011
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Raimondi et al.. Rapid method for screening enoate reductase activity in yeasts. J.Microbiol.Methods (2010), 83: 106-110 DOI: 10.1016/j.mimet.2010.09.007
Forzato et al.. Chemoenzymatic and yeast-catalysed synthesis of diastereomeric ethyl c-phenyl and c-(n-pyridyl)paraconates. Tetrahedron Asimmetry (2008), 19: 2026-2036 DOI: 10.1016/j.tetasy.2008.08.011
Request information
Insert your data to get information about this yeast