Taxon Name
Monosporozyma servazzii (Capr.) Q.M. Wang, Yurkov & Boekhout
Accession number
6355
Form of supply
agar slant
Synonymous
Saccharomyces servazzii Capriotti, Kazachstania servazzii (Capriotti) Kurtzman
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58439; CBS 4311; CCRC 21501; IFO 1838; JCM 5129; NCYC 2577; NRRL Y-12661
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces servazzii Capriotti
Isolation source
soil
Isolation Locality
FIN – Finland
Received from
CBS, Delft, The Netherlands
Date of deposit
10/10/1987
LSU (D1/D2)
GenBank U68558; GenBank AY048157; Monosporozyma_servazzii_DBVPG6355_D1D2 AGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTCGGTGCTCGAG
TTGTAATTTGTAGAGGGATACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGAC
GTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTATGTAAAGTGCCTTCGA
AGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAA
AAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTG
TTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGACTCTCGCAGCTCACTGGGCCAACATCAG
TTTTGGTGGTCGGACAAATCCGTAGGAATGTAGCTTACCTCGGTAAGTGTTATAGCCTGC
GGGAATACGGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGG
TTATATGCCGCCCGTCT
18S rRNA
GenBank AY251643
ITS1&2
GenBank AY046153
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Yarrow, Nakase. DNA base composition of species of the genus Saccharomyces. A.v.Leeuwenhoek (1975), 41: 81-88 DOI: 10.1007/BF02565038
Capriotti. Saccharomyces servazzii n. sp. A new yeast from Finland soil. Ann.Microbiol.Enzimol. (1967), 17: 79-84
Souciet et al.. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. (2001), 487: 3-12 DOI: 10.1016/S0014-5793(00)02272-9
Casaregola et al.. Genomic Exploration of the Hemiascomycetous Yeasts: 7. Saccharomyces servazzii. FEBS Lett. (2001), 487: 47-51 DOI: 10.1016/S0014-5793(00)02278-X
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-432 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Naumov, Piskur. Pheromone activity of collection strains of Saccharomyces sensu lato yeasts. Microbiology (1999), 68: 759-762
Vaughan-Martini, Kurtzman. Deoxyribonucleic Acid Relatedness Among Species of Saccharomyces Sensu Lato. Mycologia (1988), 80: 241-243 DOI: 10.1080/00275514.1988.12025526
Langkjaer et al.. Yeast genome duplication was followed by asynchronous differentiation of duplicated genes. Nature (2003), 421: 848-852 DOI: 10.1038/nature01419
Langkjaer et al.. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts. Nucleic Acids Res. (2003), 31: 3081-3091 DOI: 10.1093/nar/gkg423
Li et al.. Phylogenetic analysis of the structure of RNase MRP RNA in yeasts. RNA (2002), 8: 740-751 DOI: 10.1017.S1355838202022082
Naumov et al.. Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii. Syst.Appl.Microbiol. (1995), 18: 103-108 DOI: 10.1016/S0723-2020(11)80456-X
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Capriotti. Saccharomyces servazzii n. sp. A new yeast from Finland soil. Ann.Microbiol.Enzimol. (1967), 17: 79-84
Souciet et al.. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. (2001), 487: 3-12 DOI: 10.1016/S0014-5793(00)02272-9
Casaregola et al.. Genomic Exploration of the Hemiascomycetous Yeasts: 7. Saccharomyces servazzii. FEBS Lett. (2001), 487: 47-51 DOI: 10.1016/S0014-5793(00)02278-X
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-432 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Naumov, Piskur. Pheromone activity of collection strains of Saccharomyces sensu lato yeasts. Microbiology (1999), 68: 759-762
Vaughan-Martini, Kurtzman. Deoxyribonucleic Acid Relatedness Among Species of Saccharomyces Sensu Lato. Mycologia (1988), 80: 241-243 DOI: 10.1080/00275514.1988.12025526
Langkjaer et al.. Yeast genome duplication was followed by asynchronous differentiation of duplicated genes. Nature (2003), 421: 848-852 DOI: 10.1038/nature01419
Langkjaer et al.. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts. Nucleic Acids Res. (2003), 31: 3081-3091 DOI: 10.1093/nar/gkg423
Li et al.. Phylogenetic analysis of the structure of RNase MRP RNA in yeasts. RNA (2002), 8: 740-751 DOI: 10.1017.S1355838202022082
Naumov et al.. Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii. Syst.Appl.Microbiol. (1995), 18: 103-108 DOI: 10.1016/S0723-2020(11)80456-X
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Request information
Insert your data to get information about this yeast