Taxon Name
Brettanomyces naardenensis Kolfschoten & Yarrow
Accession number
6712
Form of supply
agar slant
Synonymous
Dekkera naardenensis S.C. Jong & F.L. Lee
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22075; CBS 6042; CCRC 21520; IFO 1588; NRRL Y-17526
Risk Group
1
GMO
No
Status of the strain
Isotype of Dekkera naardenensis S.C. Jong & F.L. Lee; Isotype of Brettanomyces naardenensis Kolfschoten & Yarrow
Isolation source
lemonade
Isolation Locality
NLD – The Netherlands
Received from
Yarrow – CBS, Delft, The Netherlands
Date of deposit
18/09/1990
LSU (D1/D2)
GenBank U76200; Brettanomyces_naardenensis DBVPG6712_D1D2 GCGGCAAAAGCTCGAATTTGAAATCCTCTTCGGAGGAGTTGTAATTTGAAGCTGGTTCTT
TAGGGAGTTTTGTTTTTGGCTGCGGAAGTGCCTTGGAACAGGCCGCCGTGGAGGGTGAGA
GCCCCGTATCGTGGCCAGCAAGATTTTCGTATAAGGGCTAGCGAAGAGTCGAGTTGTTTG
GGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATGGGCGAGAGACCG
ATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGT
ACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTATTTAGATGTCGCTTGC
CCCCGTGGCGGGCGCTCCATCTTTTTACTGGGCCAGCATCGGTGCTGGGCGGGACAGGAG
GTTTCTGTGAATGTAGCCCTTCGGGGAACTTATAGAACAGGATTCATACGTCTCTCCCCG
GTACCGAGGACTGCGGGAAACCAAGGATGCTGGCATAACGAGCAAATACCGCCCGTCTTG
A
18S rRNA
GenBank X85110
ITS1&2
GenBank AF043512
Recommended growth temperature
25°C
Recommended growth medium
YPDA+CaCO3 (Yeast Extract Peptone Glucose Agar with addition of CaCO3)
References
Kolfschoten, Yarrow. Brettanomyces naardenensis, a new yeast from soft drinks. A.v.Leeuwenhoek (1970), 36: 458-460 DOI: 10.1007/BF02069047
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Yamada et al.. The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae). Biosci.Biotechnol.Biochem. (1995), 58: 1803-1808 DOI: 10.1271/bbb.58.1803
McArthur, Clark-Walker. Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts. Curr.Genet (1983), 7: 29-35 DOI: 10.1007/BF00365677
Mitrakul et al.. Discrimination of Brettanomyces/Dekkerayeast isolates from wine by using various DNA finger-printing methods. Food Microbiol. (1999), 16: 3-14 DOI: 10.1006/fmic.1998.0217
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Hoeben et al.. Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order. J.Mol.Evol. (1993), 36: 263-269 DOI: 10.1007/BF00160482
Smith et al.. Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology. Yeast (1990), 6: 299-310 DOI: 10.1002/yea.320060403
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Yamada et al.. The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae). Biosci.Biotechnol.Biochem. (1995), 58: 1803-1808 DOI: 10.1271/bbb.58.1803
McArthur, Clark-Walker. Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts. Curr.Genet (1983), 7: 29-35 DOI: 10.1007/BF00365677
Mitrakul et al.. Discrimination of Brettanomyces/Dekkerayeast isolates from wine by using various DNA finger-printing methods. Food Microbiol. (1999), 16: 3-14 DOI: 10.1006/fmic.1998.0217
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Hoeben et al.. Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order. J.Mol.Evol. (1993), 36: 263-269 DOI: 10.1007/BF00160482
Smith et al.. Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology. Yeast (1990), 6: 299-310 DOI: 10.1002/yea.320060403
Request information
Insert your data to get information about this yeast