Taxon Name
Kluyveromyces lactis (Dombrowski) Van der Walt var. lactis
Accession number
6833
Form of supply
agar slant
Synonymous
Guilliermondella lactis (Dombrowski) Boidin et al., Kluyveromyces marxianus (E.C. Hansen) Van der Walt var. lactis (Dombrowski) Johannsen & Van der Walt, Mycoderma lactis Dombrowski, Saccharomyces lactis Dombrowski, Zygofabospora lactis (Dombrowski) Naumo
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 8585; CBS 2359; CCRC 21716; DVPG 6731; DBVPG 6564; DBVPG 6725; DBVPG 6727; DBVPG 7297; DSM 70799; IFO 1267; NRRL Y-1140; VKPM Y 1174
Risk Group
1
GMO
No
Isolation source
creamery
Isolation Locality
USA – United States of America
Received from
Frontali – Italy – University of Roma
Date of deposit
21/01/1994
Collected by
LSU (D1/D2)
Kluyveromyces_lactis_DBVPG6833_D1D2 GACGTCCGAGTTGTAATTTGAAGAAGGCAACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGCC
18S rRNA
GenBank AB054040
ITS1&2
GenBank AB054040
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1007/BF00419987
Title: The use of electrophoretic karyotypes in the classification of yeasts: Kluyveromyces marxianus and K. Lactis
Authors: Steensma et al.
Journal: Curr.Genet.
Year: 1988
Title: The use of electrophoretic karyotypes in the classification of yeasts: Kluyveromyces marxianus and K. Lactis
Authors: Steensma et al.
Journal: Curr.Genet.
Year: 1988
DOI Number: 10.1128/jb.101.2.505-512.1970
Title: Nucleic Acid Homologies Among Species of Saccharomyces
Authors: Bicknell, Douglas
Journal: J.Bacteriol.
Year: 1970
Title: Nucleic Acid Homologies Among Species of Saccharomyces
Authors: Bicknell, Douglas
Journal: J.Bacteriol.
Year: 1970
DOI Number: 10.1128/jb.145.1.382-390.1981
Title: Isolation and characterization of linear deoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated killer character
Authors: Gunge et al.
Journal: J.Bacteriol.
Year: 1981
Title: Isolation and characterization of linear deoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated killer character
Authors: Gunge et al.
Journal: J.Bacteriol.
Year: 1981
DOI Number: 10.1128/jb.147.1.155-160.1981
Title: Intergeneric transfer of deoxyribonucleic acid killer plasmids, pGKl1 and pGKl2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell fusion
Authors: Gunge, Sakaguchi
Journal: J.Bacteriol.
Year: 1981
Title: Intergeneric transfer of deoxyribonucleic acid killer plasmids, pGKl1 and pGKl2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell fusion
Authors: Gunge, Sakaguchi
Journal: J.Bacteriol.
Year: 1981
Request information
Insert your data to get information about this yeast
