Taxon Name
Starmerella bombicola Rosa & Lachance
Accession number
6870
Form of supply
agar slant
Synonymous
Candida bombicola (J.F.T. Spencer et al.) S.A. Meyer & Yarrow, Torulopsis bombicola J.F.T. Spencer et al.
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22214; CBS 6009; CCRC 21323; CCRC 22302; IFO 1449; IFO 10243; JCM 9596; NRIC 1806; NRRL Y-17069; DSMZ 27465
Risk Group
1
GMO
No
Status of the strain
Isotype of Starmerella bombicola Rosa & Lachance, Isotype of Torulopsis bombicola J.F.T. Spencer et al.
Isolation source
honey of Bombus sp.
Isolation Locality
CAN – Canada – Alberta – Pincher Creek
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
01/06/1994
LSU (D1/D2)
Starmerella_bombicola_DBVPG6870_D1D2 GTACGGCGAGTGAACAGGCAAAAGCTCAGATTTGAAAGCCTCTCGGGGCATTGTATTCTG AAGCCTTGATTCTGAGAACCGGTACCTAAGTCTTCTGGAAAGGAGCGCCAAGGAGGGTGA TAGCCCCGTACGGTACTGACCTCATTGTAGAATCTTGGCGTGGAGTCGAGTTGTTTGGGA ATGCAGCTCAAATGGGTGGTATGCTCCATCTAAAGCTAAATATCTGCGAGAGACCGATAG CGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGT GAAATTGTTGAAATGGAAGGATAGGCCGCTAACCACGTAGAGCCGTGTCTGAGGGGAGGA TAAAAGCTGTAGAATGTGGCTCTTCGGAGTGTTATAGCTACAGTGCATACTCCCACTCGG GCGCGAGGACCTAAGGCTCTGCTAAATGGTGGTCTATCACCCGTCTTGA
18S rRNA
GenBank AB013558
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
DOI Number: 10.1007/BF00169410
Title: Kinetics and balance of a fermentation free from product inhibition: sophorose lipid production by Candida bombicola
Authors: Davila et al.
Journal: Appl.Microbiol.Biotechnol.
Year: 1992
DOI Number: 10.1007/BF02069014
Title: Torulopsis bombicola sp. n.
Authors: Spencer et al.
Journal: A.v.Leeuwenhoek
Year: 1970
DOI Number: 10.1016/S0723-2020(99)80030-7
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999
DOI Number: 10.1039/C0GC00163E
Title: Sophorolipids: a yeast-derived glycolipid as greener structure directing agents for self-assembled nanomaterials
Authors: Baccile et al.
Journal: Green Chem.
Year: 2010
DOI Number: 10.1099/00207713-43-1-183
Title: Candida galacta comb. nov., a New Combination for Candida apis var. galacta
Authors: Lee et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1994
DOI Number: 10.1099/00207713-48-4-1413
Title: The yeast genus Starmerella gen. nov. and Starmerella bombicola sp. nov., the teleomorph of Candida bombicola (Spencer, Gorin & Tullock) Meyer & Yarrow
Authors: Rosa, Lachance
Journal: Int.J.Syst.Bacteriol.
Year: 1998
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997

Request information

Insert your data to get information about this yeast

    Arrow Down
    Arrow Up