Taxon Name
Xanthophyllomyces dendrorhous Golubev
Accession number
7009
Form of supply
Agar
Synonymous
Rhodomyces dendrorhous F. Ludwig, Cryptococcus rhodozymus (M.W. Miller et al.) Weijman et al., Phaffia rhodozyma M.W. Miller et al., Rhodozyma montanae Phaff et al.
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24202; CBS 5905; CCRC 21346; DSM 5626; IFO 10129; IGC 4172; NCYC 874; NRRL Y-10921; UCD 67-210; JCM 9042
Risk Group
1
GMO
No
Status of the strain
Isotype of Phaffia rhodozyma M.W. Miller et al.
Isolation source
Fagus crenata, beech tree
Isolation Locality
JPN – Japan
Received from
Teun Boekhout – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
01/06/1995
LSU (D1/D2)
GenBank AF189871; Xanthophyllomyces_dendrorhous_DBVPG7009A_D1D2 ACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCCTTCACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTG
18S rRNA
GenBank D00705
ITS1&2
GenBank AF139629
Recommended growth temperature
20°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1007/s002940050135
Title: Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma
Authors: Pfeiffer et al.
Journal: Curr.Genet.
Year: 1996
Title: Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma
Authors: Pfeiffer et al.
Journal: Curr.Genet.
Year: 1996
DOI Number: 10.1023/A:1000699626367
Title: Homothallic life cycle in the diploid red yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma)
Authors: Kucsera et al.
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Homothallic life cycle in the diploid red yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma)
Authors: Kucsera et al.
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1038/sj.jim.2900575
Title: Phaffia rhodozyma is polyploid
Authors: Medwid
Journal: J.Ind.Microbiol.Biotechnol.
Year: 1998
Title: Phaffia rhodozyma is polyploid
Authors: Medwid
Journal: J.Ind.Microbiol.Biotechnol.
Year: 1998
DOI Number: 10.1038/sj.jim.2900681
Title: Separation of strains of the yeasts Xanthophyllomyces dendrorhousand Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis
Authors: Fell, Blatt
Journal: J.Ind.Microbiol.Biotechnol.
Year: 1999
Title: Separation of strains of the yeasts Xanthophyllomyces dendrorhousand Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis
Authors: Fell, Blatt
Journal: J.Ind.Microbiol.Biotechnol.
Year: 1999
DOI Number: 10.1099/00207713-50-3-1351
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis
Authors: Fell et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
DOI Number: 10.1099/00221287-115-1-173
Title: Astaxanthin Formation by the Yeast Phaffia rhodozyma
Authors: Johnson, Lewis
Journal: J.Gen.Microbiol.
Year: 1979
Title: Astaxanthin Formation by the Yeast Phaffia rhodozyma
Authors: Johnson, Lewis
Journal: J.Gen.Microbiol.
Year: 1979
DOI Number: 10.1271/bbb1961.53.2845
Title: The Genus Phaffia is Phylogenetically Separate from the Genus Cryptococcus (Cryptococcaceae)
Authors: Yamada, Kawasaki
Journal: Agric.Biol.Chem.
Year: 1989
Title: The Genus Phaffia is Phylogenetically Separate from the Genus Cryptococcus (Cryptococcaceae)
Authors: Yamada, Kawasaki
Journal: Agric.Biol.Chem.
Year: 1989
Request information
Insert your data to get information about this yeast
