Taxon Name
Xanthophyllomyces dendrorhous Golubev
Accession number
7009
Form of supply
Agar
Synonymous
Rhodomyces dendrorhous F. Ludwig, Cryptococcus rhodozymus (M.W. Miller et al.) Weijman et al., Phaffia rhodozyma M.W. Miller et al., Rhodozyma montanae Phaff et al.
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24202; CBS 5905; CCRC 21346; DSM 5626; IFO 10129; IGC 4172; NCYC 874; NRRL Y-10921; UCD 67-210; JCM 9042
Risk Group
1
GMO
No
Status of the strain
Isotype of Phaffia rhodozyma M.W. Miller et al.
Isolation source
Fagus crenata, beech tree
Isolation Locality
JPN – Japan
Received from
Boekhout – CBS, Delft, The Netherlands
Date of deposit
01/06/1995
LSU (D1/D2)
GenBank AF189871; Xanthophyllomyces_dendrorhous_DBVPG7009A_D1D2 ACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCCTTCACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTG
18S rRNA
GenBank D00705
ITS1&2
GenBank AF139629
Recommended growth temperature
20°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Kucsera et al.. Homothallic life cycle in the diploid red yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma). A.v.Leeuwenhoek (1998), 73: 163-168 DOI: 10.1023/A:1000699626367
Yamada, Kawasaki. The Genus Phaffia is Phylogenetically Separate from the Genus Cryptococcus (Cryptococcaceae). Agric.Biol.Chem. (1989), 53: 2845-2846 DOI: 10.1271/bbb1961.53.2845
Pfeiffer et al.. Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma. Curr.Genet. (1996), 30: 294-297 DOI: 10.1007/s002940050135
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Johnson, Lewis. Astaxanthin Formation by the Yeast Phaffia rhodozyma. J.Gen.Microbiol. (1979), 115: 173-183 DOI: 10.1099/00221287-115-1-173
Medwid. Phaffia rhodozyma is polyploid. J.Ind.Microbiol.Biotechnol. (1998), 21: 228-232 DOI: 10.1038/sj.jim.2900575
Fell, Blatt. Separation of strains of the yeasts Xanthophyllomyces dendrorhousand Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J.Ind.Microbiol.Biotechnol. (1999), 23: 677-681 DOI: 10.1038/sj.jim.2900681
Andrewes, Starr. Phytochem. (1976), 15: 1009-1101
Yamada, Kawasaki. The Genus Phaffia is Phylogenetically Separate from the Genus Cryptococcus (Cryptococcaceae). Agric.Biol.Chem. (1989), 53: 2845-2846 DOI: 10.1271/bbb1961.53.2845
Pfeiffer et al.. Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma. Curr.Genet. (1996), 30: 294-297 DOI: 10.1007/s002940050135
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Johnson, Lewis. Astaxanthin Formation by the Yeast Phaffia rhodozyma. J.Gen.Microbiol. (1979), 115: 173-183 DOI: 10.1099/00221287-115-1-173
Medwid. Phaffia rhodozyma is polyploid. J.Ind.Microbiol.Biotechnol. (1998), 21: 228-232 DOI: 10.1038/sj.jim.2900575
Fell, Blatt. Separation of strains of the yeasts Xanthophyllomyces dendrorhousand Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J.Ind.Microbiol.Biotechnol. (1999), 23: 677-681 DOI: 10.1038/sj.jim.2900681
Andrewes, Starr. Phytochem. (1976), 15: 1009-1101
Request information
Insert your data to get information about this yeast