Taxon Name
Cryptococcus amylolentus (van der Walt et al.) Golubev
Accession number
7015
Form of supply
agar slant
Synonymous
Candida amylolenta Van der Walt et al., Vanrijia amylolenta (Van der Walt et al.) R.T. Moore
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 56469; CBS 6039; IFO 10423; IGC 4486; JCM 1690; NRRL Y-7784
Risk Group
1
GMO
No
Status of the strain
Isotype of Candida amylolenta Van der Walt et al.
Isolation source
frass of buprestid larvae
Isolation Locality
ZAF – South Africa
Received from
David Yarrow – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
03/11/1995
LSU (D1/D2)
GenBank AF105391; Cryptococcus_amylolentus_DBVPG7015_D1D2
CTACAGAAACGTTTTCCGTGCTGGACTGTGTCTAAGTTCCTTGGAATAGGATATCAAAGA
GGGTGACAATCCCGTACTTGACACAATCACCAGTGCTCTGTGATACGTTTTCTACGAGTC
GCGTTGCTTGGGAATGCAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGG
TGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGA
GTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGG
TTCAACCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGG
ATAAGGGCACGAGGAATGTAGCAATCTTCGGGTTGTGTTATAGCCTTGTGTCGCATACAC
TGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTT
AGGATGTTGACAAAATGGCTTTAAACGACCCGTCT
18S rRNA
GenBank AB032619
ITS1&2
GenBank AF444306
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
Title: Six new Candida species from South African insect sources
Authors: van der Walt et al.
Journal: Mycopathol.Mycol.Appl.
Year: 1972
Authors: van der Walt et al.
Journal: Mycopathol.Mycol.Appl.
Year: 1972
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1016/S1567-1356(02)00128-9
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
DOI Number: 10.1099/00207713-50-1-381
Title: Trichosporon veenhuisii sp. nov., an alkane-assimilating anamorphic basidiomycetous yeast
Authors: Middelhoven et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Trichosporon veenhuisii sp. nov., an alkane-assimilating anamorphic basidiomycetous yeast
Authors: Middelhoven et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Request information
Insert your data to get information about this yeast
