Taxon Name
Rhodotorula mucilaginosa (A. Jörgensen) F.C. Harrison var. mucilaginosa
Accession number
7019
Form of supply
Agar
Synonymous
Sporobolomyces albo-rubescens Derx, Torula mucilaginosa A. Jörgensen, Torulopsis mucilaginosa (A. Jörgensen) Ciferri & Redaelli var. mucilaginosa, Blastodendrion carbonei Ciferri & Redaelli, Blastodendrion simplex Ciferri & Redaelli, Cryptococcus corall
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 316; IFO 0890; IFO 0909; MUCL 30403; NCTC 2622; NCYC 63; VKM Y-339; IGC 5166
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula mucilaginosa Jörgensen
Received from
Boekhout – CBS, Delft, The Netherlands
Date of deposit
06/02/1996
LSU (D1/D2)
GenBank AF070432; Rhodotorula_mucilaginosa_DBVPG7019_D1D2
AGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCT
CTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGG
TGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGA
GTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCG
AGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGT
TAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAA
TCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGT
TTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGC
CTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC
CCGTC
18S rRNA
GenBank X84326
ITS1&2
GenBank AF444541
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Fell et al.. Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses. A.v.Leeuwenhoek (1998), 74: 265-270 DOI: 10.1023/A:1001714104005
Buzzini et al.. Carotenoid profiles of yeasts belonging to the genera Rhodotorula, Rhodosporidium, Sporobolomyces, and Sporidiobolus. Can.J.Microbiol. (2007), 53: 1024-1031 DOI: 10.1139/W07-068
Scorzetti et al.. Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. (2002), 2: 495-517 DOI: 10.1016/S1567-1356(02)00128-9
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Libkind et al.. Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina. Int.J.Syst.Evol.Microbiol. (2005), 55: 503-509 DOI: 10.1099/ijs.0.63322-0
Harrison. Trans.Roy.Soc.Canada (1928), Sect. V 22: 187-
Buzzini et al.. Carotenoid profiles of yeasts belonging to the genera Rhodotorula, Rhodosporidium, Sporobolomyces, and Sporidiobolus. Can.J.Microbiol. (2007), 53: 1024-1031 DOI: 10.1139/W07-068
Scorzetti et al.. Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. (2002), 2: 495-517 DOI: 10.1016/S1567-1356(02)00128-9
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Libkind et al.. Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina. Int.J.Syst.Evol.Microbiol. (2005), 55: 503-509 DOI: 10.1099/ijs.0.63322-0
Harrison. Trans.Roy.Soc.Canada (1928), Sect. V 22: 187-
Request information
Insert your data to get information about this yeast