Taxon Name
Rhodotorula mucilaginosa (A. Jörgensen) F.C. Harrison var. mucilaginosa
Accession number
7019
Form of supply
Agar
Synonymous
Sporobolomyces albo-rubescens Derx, Torula mucilaginosa A. Jörgensen, Torulopsis mucilaginosa (A. Jörgensen) Ciferri & Redaelli var. mucilaginosa, Blastodendrion carbonei Ciferri & Redaelli, Blastodendrion simplex Ciferri & Redaelli, Cryptococcus corall
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 316; IFO 0890; IFO 0909; MUCL 30403; NCTC 2622; NCYC 63; VKM Y-339; IGC 5166
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula mucilaginosa Jörgensen
Received from
Teun Boekhout – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
06/02/1996
LSU (D1/D2)
GenBank AF070432; Rhodotorula_mucilaginosa_DBVPG7019_D1D2
AGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCT
CTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGG
TGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGA
GTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCG
AGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGT
TAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAA
TCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGT
TTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGC
CTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC
CCGTC
18S rRNA
GenBank X84326
ITS1&2
GenBank AF444541
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S1567-1356(02)00128-9
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
Title: Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
Authors: Scorzetti et al.
Journal: FEMS Yeast Res.
Year: 2002
DOI Number: 10.1023/A:1001714104005
Title: Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses
Authors: Fell et al.
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses
Authors: Fell et al.
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1099/ijs.0.63322-0
Title: Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina
Authors: Libkind et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2009
Title: Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina
Authors: Libkind et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2009
DOI Number: 10.1139/W07-068
Title: Carotenoid profiles of yeasts belonging to the genera Rhodotorula, Rhodosporidium, Sporobolomyces, and Sporidiobolus
Authors: Buzzini et al.
Journal: Can.J.Microbiol.
Year: 2007
Title: Carotenoid profiles of yeasts belonging to the genera Rhodotorula, Rhodosporidium, Sporobolomyces, and Sporidiobolus
Authors: Buzzini et al.
Journal: Can.J.Microbiol.
Year: 2007
Request information
Insert your data to get information about this yeast
