Taxon Name
Maudiozyma humilis (E.E. Nel & Van der Walt) Q.M. Wang, Yurkov & Boekhout
Accession number
7219
Form of supply
agar slant
Synonymous
Kazachstania humilis (E.E. Nel & Van der Walt) Jacques, Sarilar & Casaregola, Torulopsis humilis E.E. Nel & Van der Walt, Candida milleri Yarrow, Torulopsis acidi-lactici Nakase et al., Torulopsis holmii (A. Jörgensen) Lodder var. acidi-lactici C. Ramírez & Sierra; Candida humilis (E.E. Nel & van der Walt) S.A. Meyer & Yarrow; Candida milleri Yarrow
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22992; CBS 5658; CCRC 21626; IFO 10280; JCM 9852; NRRL Y-17074
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis humilis Nel & Van der Walt
Isolation source
Bantu beer
Isolation Locality
ZAF – South Africa
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
09/12/1999
LSU (D1/D2)
GenBank AF399778; Maudiozyma_humilis_DBVPG7219_D1D2
AATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAGGGCGACTTTGGGGCGGCTCCT
TGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTG
CGGTTCCGTGTAAAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGG
TGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGA
TGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGG
AAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCCCGCTCCTTGTGGGTGGGGGACTCT
CGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCCGGACAAAACTGCAGGAACGTAGCTT
GCTTCGGGAAGTGTTACAGCCTGCAGGAATACGGCCAGCCGGGACTGAGGAATGCGATTC
GTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTG
18S rRNA
GenBank AB054678
ITS1&2
GenBank AY046174; GenBank KX951501
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
Title: Morphological and molecular studies in the genus Tremella
Authors: Chen
Journal: Bibliotheca Mycologica
Year: 1998
Authors: Chen
Journal: Bibliotheca Mycologica
Year: 1998
DOI Number: 10.1007/BF02057169
Title: Torulopsis humilis, Sp. N.
Authors: Nel, van der Wal
Journal: Mycopathol.Mycol.Appl
Year: 1968
Title: Torulopsis humilis, Sp. N.
Authors: Nel, van der Wal
Journal: Mycopathol.Mycol.Appl
Year: 1968
DOI Number: 10.1016/S0168-1605(03)00248-4
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1111/j.1567-1364.2007.00342.x
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Request information
Insert your data to get information about this yeast
