Taxon Name
Saccharomyces kudriavzevii Naumov, James, Naumova, Louis & Roberts
Accession number
7267
Form of supply
agar slant
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC MYA-4449; AS 2.2408; CBS 8840; IFO 1802; IFO 1802-2D; NCYC 2889; MUCL 46198;
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces kudriavzevii Naumov G.I. et al.
Isolation source
decayed leaf
Isolation Locality
JPN – Japan
Received from
Stephen A. James – Great Britain – Norwich Research Park
Date of deposit
05/02/2001
LSU (D1/D2)
GenBank AB040995; Saccharomyces_kudriavzevii_DBVPG7267_D1D2
TTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGAACCG
TTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAG
GAGTGCGGTTCTTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTA
AGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTA
CAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTG
AAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGG
GAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATG
TAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCAGCTGGGACTGAGGACTG
CGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTg
18S rRNA
GenBank AJ271811
ITS1&2
GenBank AJ271805; GenBank AJ271806
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1016/j.cub.2004.05.054
Title: A phylogenetically based secondary structure for the yeast telomerase RNA
Authors: Dandjinou et al.
Journal: Curr.Biol.
Year: 2004
Title: A phylogenetically based secondary structure for the yeast telomerase RNA
Authors: Dandjinou et al.
Journal: Curr.Biol.
Year: 2004
DOI Number: 10.1073/pnas.0404319101
Title: Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts
Authors: Hittinger et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
Title: Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts
Authors: Hittinger et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
DOI Number: 10.1073/pnas.0405879101
Title: A universal telomerase RNA core structure includes structured motifs required for binding the telomerase reverse transcriptase protein
Authors: Lin et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
Title: A universal telomerase RNA core structure includes structured motifs required for binding the telomerase reverse transcriptase protein
Authors: Lin et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
DOI Number: 10.1099/00207713-50-5-1931
Title: Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae
Authors: Naumov et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae
Authors: Naumov et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
DOI Number: 10.1126/science.1084337
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
DOI Number: 10.2323/jgam.41.499
Title: Two new genetically isolated populations of the Saccharomyces sensu stricto complex from Japan
Authors: Naumov et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1995
Title: Two new genetically isolated populations of the Saccharomyces sensu stricto complex from Japan
Authors: Naumov et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1995
Request information
Insert your data to get information about this yeast
