Taxon Name
Saccharomyces mikatae Naumov, James, Naumova, Louis & Roberts
Accession number
7269
Form of supply
agar slant
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
IFO 1815; IFO 1815-2A; CBS 8839; NCYC 2888; AS 2.2407; DBVPG 7991; MUCL 46199; ATCC MYA-4448
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces mikatae Naumov G.I. et al.
Isolation source
soil
Isolation Locality
JPN – Japan
Received from
Stephen A. James – Great Britain – Norwich Research Park
Date of deposit
05/02/2001
LSU (D1/D2)
GenBank AB040996; Saccharomyces_mikatae_DBVPG7269_D1D2
GCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAG
GGCAATTTCGAGACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAG
AATCCCGTGTGGCGAGGAGTGCGGTTCTCAATGTGAAATGCCTTCGAAGAGTCGAGTTGT
TTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGA
CCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAA
AGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCT
GCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGG
ATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCA
GCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCC
GT
18S rRNA
GenBank AB040998
ITS1&2
GenBank AJ271807; GenBank AJ271808
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1016/j.cub.2004.05.054
Title: A phylogenetically based secondary structure for the yeast telomerase RNA
Authors: Dandjinou et al.
Journal: Curr.Biol.
Year: 2004
Title: A phylogenetically based secondary structure for the yeast telomerase RNA
Authors: Dandjinou et al.
Journal: Curr.Biol.
Year: 2004
DOI Number: 10.1038/nature01644
Title: Sequencing and comparison of yeast species to identify genes and regulatory elements
Authors: Kellis et al.
Journal: Nature
Year: 2004
Title: Sequencing and comparison of yeast species to identify genes and regulatory elements
Authors: Kellis et al.
Journal: Nature
Year: 2004
DOI Number: 10.1073/pnas.0404319101
Title: Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts
Authors: Hittinger et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
Title: Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts
Authors: Hittinger et al.
Journal: Proc.Natl.Acad.Sci.US
Year: 2004
DOI Number: 10.1099/00207713-50-5-1931
Title: Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae
Authors: Naumov et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae
Authors: Naumov et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
DOI Number: 10.1126/science.1084337
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
Title: Finding functional features in Saccharomyces genomes by phylogenetic footprinting
Authors: Cliften et al.
Journal: Science
Year: 2003
DOI Number: 10.2323/jgam.41.499
Title: Two new genetically isolated populations of the Saccharomyces sensu stricto complex from Japan
Authors: Naumov et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1995
Title: Two new genetically isolated populations of the Saccharomyces sensu stricto complex from Japan
Authors: Naumov et al.
Journal: J.Gen.Appl.Microbiol.
Year: 1995
Request information
Insert your data to get information about this yeast
