Taxon Name
Pichia fermentans Lodder var. fermentans
Accession number
7272
Form of supply
agar slant
Synonymous
Zymopichia fermentans (Lodder) E.K. Novák & Zsolt, Candida fimetaria Soneda var. fimetaria, Candida krusei (Castellani) Berkhout var. transitoria Saÿz, Candida lambica (Lindner & Genoud) van Uden & H.R. Buckley, Candida monosa (Kluyver) Diddens & Lodder
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 10651; CBS 187; CCRC 22090; IFO 1124; NCAIM Y.00086; NCYC 850; NRRL Y-1619
Risk Group
1
GMO
No
Status of the strain
Isotype of Pichia fermentans Lodder
Isolation source
buttermilk
Isolation Locality
NLD – The Netherlands
Received from
Tornai-Lehoczki – Hungary – National Collection of Agricultural and Industrial Microorganisms (NCAIM)
Date of deposit
15/02/2001
LSU (D1/D2)
GenBank U75726; Pichia_fermentans_DBVPG7272_D1D2
AAAGCTCAGATTTGGAATCGCTTCGGCGAGTTGTGAATTGCAGGTTGGCGCCTCTGCGGC
GGCGGCGGTCCAAGTCCCTTGGAACAGGGCGCCATTGAGGGTGAGAGCCCCGTGGGACCG
TTTGCCTACGCTCTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGC
GGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTG
TGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAA
GGGAAGGGTATTGCGCCCGACATGGAGCGTGCGCACCGCTGCCCCTCGTGGGCGGCGCTC
TGGGCGTGCTCTGGGCCAGCATCGGTTTTTGCCGCGGGAGAAGGGCGGCGGGCATGTAGC
TCTTCGGAGTGTTATAGCCTGCCGCCGGCGCCGCGAGCGGGGACCGAGGACTGCGACTTT
TGTCTCGGATGCTGGCACAACGGCGCAACACCGCCCGTCTTGA
18S rRNA
GenBank EF550372
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-30-1-217
Title: Deoxyribonucleic Acid Base Sequence Relatedness Among Strains of Pichia ohmeri That Produce Dimorphic Ascospores
Authors: Fuson et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1980
Title: Deoxyribonucleic Acid Base Sequence Relatedness Among Strains of Pichia ohmeri That Produce Dimorphic Ascospores
Authors: Fuson et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1980
DOI Number: 10.1099/00207713-48-1-279
Title: Differentiation and species identification of yeasts using PCR
Authors: de Barros Lopes et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
Title: Differentiation and species identification of yeasts using PCR
Authors: de Barros Lopes et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
DOI Number: 10.1099/00207713-51-4-1593
Title: Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs
Authors: Daniel et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
Title: Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs
Authors: Daniel et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2001
Request information
Insert your data to get information about this yeast
