Taxon Name
Kodamaea ohmeri (Etchells & Bell) Y. Yamada et al.
Accession number
7278
Form of supply
agar slant
Synonymous
Endomycopsis ohmeri Etchells & Bell var. ohmeri, Pichia ohmeri (Etchells & Bell) Kreger-van Rij, Yamadazyma ohmeri (Etchells & Bell) Billon-Grand, Candida guilliermondii (Castellani) Langeron & Guerra var. membranifaciens Lodder & Kreger-van Rij, Candida
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 46053; CBS 5367; CCRC 22178; IFO 1271; NCAIM Y.01001; NRRL Y-1932; UCD 75-73
Risk Group
1
GMO
No
Status of the strain
Isotype of Endomycopsis ohmeri Etchells & T.A. Bell
Isolation source
cucumber brine
Isolation Locality
USA – United States of America
Received from
Tornai-Lehoczki – Hungary – National Collection of Agricultural and Industrial Microorganisms (NCAIM)
Date of deposit
15/02/2001
LSU (D1/D2)
GenBank U45702
18S rRNA
GenBank AF335946
ITS1&2
GenBank AF335946; Kodamaea_ohmeri_DBVPG7278_ITS TCTATCTAAAAACAATTCTTTACAAGAAATTCTTAAAACTTTCAACAACGGATCTCTTGG
TTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATACGAATCGCAGCTCTCGG
AATCATCGAATCTTTGAACGCACATTGCACCATTGGGTATTCCCAATGGTATGCTTGTTT
GAGCGAATACTTCCCTAATCCTCACGGATTGTATTGTGTTTGCACGAAAATAATGACGAC
AGTACTCTACAAAACGGTACCGTCAGTACACTCATTTTTTTTCCTCAAATCAAGTAGGAC
TACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTC
AGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCCCCCGGGGAGTTGTAATT
TGAAGATTGCGTCTTGGAGGCGACCGTGTCTATGTTCCTTGGAACAGGACGTCACAGAGG
GTGAGAATCCCGTGCGGCACGGCCCCCGGCTCCTTATAAGGCGCTCTCGACGAGTCGAGT
TGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAG
AGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGA
AACAGCACGTGAAATTGTTGAAAGGGAAGGGCATGCCGTCAGATTGTCAGTGTGGGTAAG
AAGCGGGGTACAAAGACTGTGGAACGTGGCCCTCGGGTGTTATAGCCGCAGTTCATGCCC
CGTCTCTTTCCGAGGCCTGCTTTGAGGACACCGACGTAATGACGGTACGCC
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Film yeasts on commercial cucumber brines
Authors: Etchells, Bell
Journal: Food Technol.
Year: 1950
Authors: Etchells, Bell
Journal: Food Technol.
Year: 1950
DOI Number: 10.1016/S0168-1605(03)00248-4
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
DOI Number: 10.1099/00207713-30-1-217
Title: Deoxyribonucleic Acid Base Sequence Relatedness Among Strains of Pichia ohmeri That Produce Dimorphic Ascospores
Authors: Fuson et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1980
Title: Deoxyribonucleic Acid Base Sequence Relatedness Among Strains of Pichia ohmeri That Produce Dimorphic Ascospores
Authors: Fuson et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1980
DOI Number: 10.1111/j.1567-1364.2007.00342.x
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
DOI Number: 10.1128/JCM.39.11.4042-4051.2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
DOI Number: 10.1271/bbb.59.1172
Title: The Phylogeny of Yamadazyma ohmeri (ETCHELLS et BELL) BILLON-GRAND Based on the Partial Sequences of 18S and 26S Ribosomal RNAs: The Proposal of Kodamaea Gen. Nov. (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Title: The Phylogeny of Yamadazyma ohmeri (ETCHELLS et BELL) BILLON-GRAND Based on the Partial Sequences of 18S and 26S Ribosomal RNAs: The Proposal of Kodamaea Gen. Nov. (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Request information
Insert your data to get information about this yeast
