Taxon Name
Candidozyma haemuli (Uden & Kolip.) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai
Accession number
7356
Form of supply
agar slant
Synonymous
Torulopsis haemulonii van Uden & Kolipinski, Candida haemulonis (van Uden & Kolipinski) S.A. Meyer & Yarrow
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22991; CBS 5149; DBVPG 6958; IFO 10001; IGC 3025; JCM 3762; NRRL Y-6693
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis haemulonii van Uden & Kolipinski
Isolation source
gut of Haemulon siurus, blue-striped grunt fish
Isolation Locality
USA – United States of America
Received from
Yarrow – CBS, Delft, The Netherlands
Date of deposit
15/09/2002
LSU (D1/D2)
GenBank U44812; Candidozyma_haemuli_DBVPG7356_D1D2
CGCTGCGGCGAGTTGTAGTCTGGAGGTGGCCGGTCCCGGCGCCAGCGCGCAGCCAAGTCC
TTTGGAACAAGGCGCCTGAGAGGGTGACAGCCCCGTGGCAGTTTGTGCTGGTGCCGCCTC
GGCCCACCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATC
TAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTAATGGAAAGATGAAAA
GCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCACCC
AGACACGGCCTTCTGGCCGGGCCAGCATCGGGTGGGAGGGAGCGACAACGAGCAGTCGAT
GTAGTACAGCCCTCTGGGCTGTGCATTATACGTCTTGCTTTCTGGCTCCTCTCCCGCCCG
AGGACCGCAGCAATAAGGATGCTGGCGCAATGGTTGCAAGCCACCCG
18S rRNA
GenBank AB013572
ITS1&2
GenBank AB118789
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
van Uden, do Carmo-Sousa. On the intestinal yeast flora of free living hippopotami(Hippopotamus amphibius), wart hogs(Phacochoerus aethiopicus) and bush pigs(Potamochoerus choeropotamus). A.v.Leeuwenhoek (1962), 28: 78-80 DOI: 10.1007/BF02538723
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Lehmann et al.. Unrelatedness of groups of yeasts within the Candida haemulonii complex. J.Clin.Microbiol. (1993), 31: 1683-1687 DOI: 10.1128/jcm.31.7.1683-1687.1993
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Pryce et al.. Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system. Med.Mycol. (2003), 41: 369-381 DOI: 10.1080/13693780310001600435
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Sugita, Nakase. Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida. Syst.Appl.Microbiol. (1999), 22: 79-86 DOI: 10.1016/S0723-2020(99)80030-7
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Lehmann et al.. Unrelatedness of groups of yeasts within the Candida haemulonii complex. J.Clin.Microbiol. (1993), 31: 1683-1687 DOI: 10.1128/jcm.31.7.1683-1687.1993
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Pryce et al.. Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system. Med.Mycol. (2003), 41: 369-381 DOI: 10.1080/13693780310001600435
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Sugita, Nakase. Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida. Syst.Appl.Microbiol. (1999), 22: 79-86 DOI: 10.1016/S0723-2020(99)80030-7
Request information
Insert your data to get information about this yeast