Taxon Name
Sporidiobolus salmonicolor Fell & Tallman
Accession number
7998
Form of supply
agar slant
Synonymous
Blastoderma salmonicolor B. Fischer & Brebeck, Sporobolomyces salmonicolor (Fischer & Brebeck) Kluyver & van Niel var. salmonicolor, Aessosporon salmonicolor Van der Walt, Candida kochii (von Wettstein) Basgal, Monilia kochii (von Wettstein) Saccardo, Pro
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 36400; CBS 490; DBVPG 6654; IGC 4111; JCM 1841; NCYC 891; NRRL Y-5483; NRRL Y-17301; VKM Y-685; UCD 68-371
Risk Group
1
GMO
No
Status of the strain
Isotype of Sporobolomyces salmonicolor (Fischer & Brebeck) Kluyver & van Niel; Isotype of Sporidiobolus salmonicolor Fell & Statzell Tallman
Isolation source
culture of Torula flavescens
Received from
Miller – UCD, Davis, CA, USA
Date of deposit
25/08/1989
LSU (D1/D2)
GenBank AF070439; Sporobolomyces_salmonicolor_DBVPG7998_D1D2 GTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGCTTTCGGCGTCCGAG
TTGTAATCTCGAGAAGTGTTTTCCGCGTCAGACCGCACACAAGTCTCCTGGAACGGAGCG
TCACAGTGGTGAGAACCCAGTACACGGTGCGGATGCCTGATGCTTTGTGATACACTTTCG
AAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAA
ATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGG
AAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTA
TTCGGAGCTTGCTTCGATTCGCAGGCCCGCATCAGTTTTCCGGGGCGGAAAATCGTAAGG
AGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTTTACTGGATTCGTCCTGGGGGACTGAG
GAACGCAGCGTGCTTTTTGCATGGGCTTCGGCCCATCCACGCTTAGGATGCGGGTGGAAT
GGCTTTAAACGACCCGTCTTGAACCACGGACC
18S rRNA
GenBank AB021697
ITS1&2
GenBank AY015434
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Fell et al.. Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses. A.v.Leeuwenhoek (1998), 74: 265-270 DOI: 10.1023/A:1001714104005
Sugiyama et al.. Sympodiomycopsis: a new yeast-like anamorph genus with basidiomycetous nature from orchid nectar. A.v.Leeuwenhoek (1991), 59: 95-108 DOI: 10.1007/BF00445653
Sampaio. Utilization of low molecular weight aromatic compounds by heterobasidiomycetous yeasts: Taxonomic implications. Can.J.Microbiol. (1999), 45: 491-512 DOI: 10.1139/w99-020
Fell, Statzell-Tallman. Heterothallism in the basidiomycetous yeast genus Sporidiobolus Nyland. Curr.Microbiol. (1981), 5: 77-82 DOI: 10.1007/BF01567423
Fell et al.. Recognition of the basidiomycetous yeast Sporobolomyces ruberrimus sp. nov. as a distinct species based on molecular and morphological analyses. FEMS Yeast Res. (2002), 1: 265-270 DOI: 10.1016/S1567-1356(01)00039-3
Sampaio et al.. Curvibasidium cygneicollum gen. nov., sp. nov. and Curvibasidium pallidicorallinum sp. nov., novel taxa in the microbotryomycetidae (Urediniomycetes), and their relationship with Rhodotorula fujisanensis and Rhodotorula nothofagi. Int.J.Syst.Evol.Microbiol. (2004), 54: 1401-1407 DOI: 10.1099/ijs.0.03037-0
Libkind et al.. Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina. Int.J.Syst.Evol.Microbiol. (2005), 55: 503-509 DOI: 10.1099/ijs.0.63322-0
Hamamoto, Nakase. Phylogenetic analysis of the ballistoconidium-forming yeast genus Sporobolomyces based on 18S rDNA sequences. Int.J.Syst.Evol.Microbiol. (2000), 50: 1373-1380 DOI: 10.1099/00207713-50-3-1373
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Kluyver, van Niel. Zentralbl.Bakteriol.Parasitenkd. (1924), Abt.II 61: 1-20
Sugiyama et al.. Sympodiomycopsis: a new yeast-like anamorph genus with basidiomycetous nature from orchid nectar. A.v.Leeuwenhoek (1991), 59: 95-108 DOI: 10.1007/BF00445653
Sampaio. Utilization of low molecular weight aromatic compounds by heterobasidiomycetous yeasts: Taxonomic implications. Can.J.Microbiol. (1999), 45: 491-512 DOI: 10.1139/w99-020
Fell, Statzell-Tallman. Heterothallism in the basidiomycetous yeast genus Sporidiobolus Nyland. Curr.Microbiol. (1981), 5: 77-82 DOI: 10.1007/BF01567423
Fell et al.. Recognition of the basidiomycetous yeast Sporobolomyces ruberrimus sp. nov. as a distinct species based on molecular and morphological analyses. FEMS Yeast Res. (2002), 1: 265-270 DOI: 10.1016/S1567-1356(01)00039-3
Sampaio et al.. Curvibasidium cygneicollum gen. nov., sp. nov. and Curvibasidium pallidicorallinum sp. nov., novel taxa in the microbotryomycetidae (Urediniomycetes), and their relationship with Rhodotorula fujisanensis and Rhodotorula nothofagi. Int.J.Syst.Evol.Microbiol. (2004), 54: 1401-1407 DOI: 10.1099/ijs.0.03037-0
Libkind et al.. Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina. Int.J.Syst.Evol.Microbiol. (2005), 55: 503-509 DOI: 10.1099/ijs.0.63322-0
Hamamoto, Nakase. Phylogenetic analysis of the ballistoconidium-forming yeast genus Sporobolomyces based on 18S rDNA sequences. Int.J.Syst.Evol.Microbiol. (2000), 50: 1373-1380 DOI: 10.1099/00207713-50-3-1373
Chen et al. Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J.Clin.Microbiol. (2001), 39: 4042-4051 DOI: 10.1128/JCM.39.11.4042-4051.2001
Kluyver, van Niel. Zentralbl.Bakteriol.Parasitenkd. (1924), Abt.II 61: 1-20
Request information
Insert your data to get information about this yeast