Taxon Name
Saccharomyces cerevisiae Meyen ex E.C. Hansen
Accession number
1373
Form of supply
agar slant
Synonymous
Candida robusta Diddens & Lodder, Cryptococcus fermentans (Mrak & McClung) C.E. Skinner et al., Hormiscium cerevisiae Bail, Mycotorula robusta (Diddens & Lodder) Krasil\’nikov, Saccharomyces aceti Santa María, Saccharomyces acidosaccharophillii Kawano et
Restrictions on use
For commercial development a special agreement is requested
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Risk Group
1
GMO
No
Isolation source
soil
Isolation Locality
NLD – The Netherlands
Received from
Augusto Capriotti – Italy – University of Perugia
Date of deposit
01/01/1952
LSU (D1/D2)
Saccharomyces_cerevisiae_DBVPG1373_D1D2 CTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/yea.1200
Title: Inferences of evolutionary relationships from a population survey of LTR-retrotransposons and telomeric-associated sequences in the Saccharomyces sensu stricto complex
Authors: Liti et al.
Journal: Yeast
Year: 2005
DOI Number: 10.1002/yea.1601
Title: Relatedness of medically important strains of Saccharomyces cerevisiae as revealed by phylogenetics and metabolomics
Authors: MacKenzie et al.
Journal: Yeast
Year: 2008
DOI Number: 10.1111/j.1567-1364.2009.00583.x
Title: Generation of a large set of genetically tractable haploid and diploid Saccharomyces strains
Authors: Cubillos et al.
Journal: FEMS Yeast Res.
Year: 2009
DOI Number: 10.1111/mec.13341
Title: A population genomics insight into the Mediterranean origins of wine yeast domestication
Authors: Almeida et al
Journal: Molec.Ecol.
Year: 2015
DOI Number: 10.1534/genetics.106.062166
Title: Sequence diversity, reproductive isolation and species concepts in Saccharomyces
Authors: Liti et al.
Journal: Genetics
Year: 2006

Richiedi informazioni

Inserisci i tuoi dati per ricevere informazioni su questo lievito

    Arrow Down
    Arrow Up