Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Brettanomyces anomalus Custer
Accession number
4075
Form of supply
agar slant
Synonymous
Dekkera anomala M.T. Smith & van Grinsven, Brettanomyces cidri Legakis, Brettanomyces claussenii Custers var. claussenii, Brettanomyces claussenii Custers var. sablieri Legakis, Brettanomyces dublinensis Gilliland, Candida beijingensis J.Z. Yue, Dekkera c
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 10559; CBS 77; CCRC 21512; IFO 0796; NRRL Y-1415; VKM Y-19
Risk Group
1
GMO
No
Status of the strain
Isotype of Brettanomyces anomalus Custers
Isolation source
stout beer
Isolation Locality
GBR – Great Britain
Received from
CBS, Delft, The Netherlands
Date of deposit
01/01/1965
LSU (D1/D2)
GenBank AY969052; Brettanomyces_anomalus_DBVPG4075_D1D2 TGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCAGGCCCTCGCGGCTTGAGTTGTAATTTGGAGACGGGATACTAGAGAGAGGGAGGGCGACTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAGTCGCGTGAACTTGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGCAGGCGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCCAGCCAGACGTGGCTATCCGGGACCGGGGACTGCGGCGATTCTATCGCCAAGGATGCTGGCAGAACGAGCAAATACCGCCCGTCTTGA
18S rRNA
GenBank D32116
ITS1&2
GenBank AF043510
Recommended growth temperature
25°C
Recommended growth medium
YPDA+CaCO3 (Yeast Extract Peptone Glucose Agar with addition of CaCO3)
References
Yamada et al.. The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae). Biosci.Biotechnol.Biochem. (1995), 58: 1803-1808 DOI: 10.1271/bbb.58.1803
McArthur, Clark-Walker. Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts. Curr.Genet (1983), 7: 29-35 DOI: 10.1007/BF00365677
Mitrakul et al.. Discrimination of Brettanomyces/Dekkerayeast isolates from wine by using various DNA finger-printing methods. Food Microbiol. (1999), 16: 3-14 DOI: 10.1006/fmic.1998.0217
Hoeben et al.. Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order. J.Mol.Evol. (1993), 36: 263-269 DOI: 10.1007/BF00160482
Smith et al.. Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology. Yeast (1990), 6: 299-310 DOI: 10.1002/yea.320060403
McArthur, Clark-Walker. Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts. Curr.Genet (1983), 7: 29-35 DOI: 10.1007/BF00365677
Mitrakul et al.. Discrimination of Brettanomyces/Dekkerayeast isolates from wine by using various DNA finger-printing methods. Food Microbiol. (1999), 16: 3-14 DOI: 10.1006/fmic.1998.0217
Hoeben et al.. Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order. J.Mol.Evol. (1993), 36: 263-269 DOI: 10.1007/BF00160482
Smith et al.. Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology. Yeast (1990), 6: 299-310 DOI: 10.1002/yea.320060403
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito