Taxon Name
Naganishia diffluens (Zach) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6002
Form of supply
Agar
Synonymous
Cryptococcus albidus (Saito) C.E. Skinner var. diffluens (Zach) Phaff & Fell, Cryptococcus diffluens (Zach) Lodder & Kreger-van Rij var. uruguaiensis Artagaveytia-Allende & Aciole de Queiroz, Rhodotorula diffluens (Zach) T. Hasegawa et al., Rhodotorula ge
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 12307; CBS 160; IFO 0612; IGC 2872; JCM 3688; MUCL 30402; NRRL Y-1505; VKM Y-1592
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis diffluens Zach
Isolation source
diseased fingernails
Isolation Locality
AUT – Austria
Received from
LSU (D1/D2)
GenBank AF075502; Naganishia_diffluens_DBVPG6002_D1D2
CGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTT
GTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTC
ATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAA
CGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGA
AAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTC
TTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGAGCGATGGATAAAGGCACT
AGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTAGCGTCATATACATTGTTTGGGACTG
AGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACA
TAATGGCTTTAAACGACCCGTC
18S rRNA
GenBank AB032617
ITS1&2
GenBank AF145330
Recommended growth temperature
20°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
Title: Uber durch niedere Pilze verursachte Nagelerkrankungen beim Menschen
Authors: Wolfram, Zach
Journal: Arch.Dermatol.Syph.
Year: 1934
Authors: Wolfram, Zach
Journal: Arch.Dermatol.Syph.
Year: 1934
DOI Number: 10.1016/j.femsyr.2004.10.011
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
Title: Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts
Authors: Buzzini et al.
Journal: FEMS Yeast Res.
Year: 2005
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1023/A:1002124504936
Title: Cryptococcus adeliensis sp. nov., a xylanase producing basidiomycetous yeast from Antarctica
Authors: Scorzetti et al.
Journal: A.v.Leeuwenhoek
Year: 2000
Title: Cryptococcus adeliensis sp. nov., a xylanase producing basidiomycetous yeast from Antarctica
Authors: Scorzetti et al.
Journal: A.v.Leeuwenhoek
Year: 2000
DOI Number: 10.1099/00207713-49-2-907
Title: Cystofilobasidiales, a new order of basidiomycetous yeasts
Authors: Fell et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Cystofilobasidiales, a new order of basidiomycetous yeasts
Authors: Fell et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
DOI Number: 10.1111/j.1348-0421.2001.tb02621.x
Title: Intraspecies Diversity of Cryptococcus albidus Isolated from Humans as Revealed by Sequences of the Internal Transcribed Spacer Regions
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2001
Title: Intraspecies Diversity of Cryptococcus albidus Isolated from Humans as Revealed by Sequences of the Internal Transcribed Spacer Regions
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2001
DOI Number: 10.1111/j.1348-0421.2003.tb03468.x
Title: The Basidiomycetous Yeasts Cryptococcus diffluens and C. liquefaciens Colonize the Skin of Patients with Atopic Dermatitis
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2003
Title: The Basidiomycetous Yeasts Cryptococcus diffluens and C. liquefaciens Colonize the Skin of Patients with Atopic Dermatitis
Authors: Sugita et al.
Journal: Microbiol.Immunol.
Year: 2003
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
