Taxon Name
Naganishia albida (Saito) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6059
Form of supply
agar slant
Synonymous
Cryptococcus albidus (Saito) C.E. Skinner et al., Rhodotorula albida (Saito) Galg?czy & E.K. Novák, Torula albida Saito, Torulopsis albida (Saito) Lodder var. albida, Torulopsis neoformans (Sanfelice) Redaelli var. albida (Saito) W. Kaufman, Cryptococcus
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22025; CBS 1926; CCY 17-11-1; IFO 1866; IGC 3941; MUCL 30419; NRRL Y-6964; JCM 9037; UCD 68-196
Risk Group
1
GMO
No
Status of the strain
Isotype of Cryptococcus kuetzingii Fell&Phaff
Isolation source
fruit of medlar, Mespilus sp.
Received from
Miller – UCD, Davis, CA, USA
LSU (D1/D2)
GenBank AF137602; Naganishia_albida_DBVPG6059_D1D2
AATTTGAAATCTGGTAGCCTTCGGTTGCCCGAGTTGTAATCTAGAGAAGTGTTTTCCGTG
CCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTG
ACATGGACCCCCGGTGCTTTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAG
CTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC
AAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT
TGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTGGGACTTACCTCCCTTGAGTGGG
GTCAACATCAGTTTTGATCGATGGATAAAGGCACGGGGAAGGTAGCACTCTCGGGTGAAC
TTATAGCCTCGCGTCATATACATATACATTGATTGGGACTGAGGAACGCAGCATGCCTTT
TGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGACCCG
18S rRNA
GenBank AB032639
ITS1&2
GenBank AF145327
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Fell, Phaff. Three new yeasts; Cryptococcus dimennae, Cryptococcus kutzingii and Cryptococcus lactativorus spp. n.. A.v.Leeuwenhoek (1967), 33: 464-472 DOI: 10.1007/BF02045598
Scorzetti et al.. Cryptococcus adeliensis sp. nov., a xylanase producing basidiomycetous yeast from Antarctica. A.v.Leeuwenhoek (2000), 77: 153-157 DOI: 10.1023/A:1002124504936
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Scorzetti et al.. Cryptococcus adeliensis sp. nov., a xylanase producing basidiomycetous yeast from Antarctica. A.v.Leeuwenhoek (2000), 77: 153-157 DOI: 10.1023/A:1002124504936
Fell et al.. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int.J.Syst.Evol.Microbiol. (2000), 50: 1351-1371 DOI: 10.1099/00207713-50-3-1351
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito