Taxon Name
Kluyveromyces marxianus (E.C. Hansen) Van der Walt var. marxianus
Accession number
6071
Form of supply
agar slant
Synonymous
Dekkeromyces marxianus (E.C. Hansen) E.K. Novák & Zsolt, Guilliermondella marxiana (E.C. Hansen) Boidin et al., Saccharomyces marxianus E.C. Hansen, Zygofabospora marxiana (E.C. Hansen) Kudryavtsev, Zygorenospora marxiana (E.C. Hansen) Krasil\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 16045; CBS 2762; CCRC 21623; NCYC 970; NRRL Y-4327; UCD 71-13
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces fragilis Jörgensen var. bulgaricus Santa María
Isolation source
yogurt
Received from
Miller – UCD, Davis, CA, USA
LSU (D1/D2)
Kluyveromyces_marxianus_DBVPG6071_D1D2
AATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGC
TGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCG
AGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCT
AAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
ACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTT
GAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATC
AGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGC
CCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTA
ATGGTTAAATGCCGCCCGTCTTGA
18S rRNA
GenBank X89524
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Santa María. Saccharomyces fragilis Jorgensen var. bulgaricus nov. var.. An.Inst.Nac.Invest.Agron. (1956), 5: 163-166
Vaughan-Martini et al.. Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus. Biotechnol.Tech. (1988), 2: 293-296 DOI: 0.1007/BF01875545
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Mahmoud, Kosikowski. Alcohol and Single Cell Protein Production by Kluyveromyces in Concentrated Whey Permeates with Reduced Ash. J.Dairy Sci. (1982), 65: 2082-2087 DOI: 10.3168/jds.S0022-0302(82)82465-X
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Vaughan-Martini et al.. Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus. Biotechnol.Tech. (1988), 2: 293-296 DOI: 0.1007/BF01875545
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Mahmoud, Kosikowski. Alcohol and Single Cell Protein Production by Kluyveromyces in Concentrated Whey Permeates with Reduced Ash. J.Dairy Sci. (1982), 65: 2082-2087 DOI: 10.3168/jds.S0022-0302(82)82465-X
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito