Taxon Name
Kluyveromyces marxianus (E.C. Hansen) Van der Walt var. marxianus
Accession number
6071
Form of supply
agar slant
Synonymous
Dekkeromyces marxianus (E.C. Hansen) E.K. Novák & Zsolt, Guilliermondella marxiana (E.C. Hansen) Boidin et al., Saccharomyces marxianus E.C. Hansen, Zygofabospora marxiana (E.C. Hansen) Kudryavtsev, Zygorenospora marxiana (E.C. Hansen) Krasil\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 16045; CBS 2762; CCRC 21623; NCYC 970; NRRL Y-4327; UCD 71-13
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces fragilis Jörgensen var. bulgaricus Santa María
Isolation source
yogurt
Received from
Marty Miller – USA – University of California – Davis
LSU (D1/D2)
Kluyveromyces_marxianus_DBVPG6071_D1D2
AATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGC
TGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCG
AGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCT
AAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT
ACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTT
GAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATC
AGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGC
CCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTA
ATGGTTAAATGCCGCCCGTCTTGA
18S rRNA
GenBank X89524
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Saccharomyces fragilis Jorgensen var. bulgaricus nov. var.
Authors: Santa Maria
Journal: An.Inst.Nac.Invest.Agron.
Year: 1956
Authors: Santa Maria
Journal: An.Inst.Nac.Invest.Agron.
Year: 1956
DOI Number: 0.1007/BF01875545
Title: Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus
Authors: Vaughan-Martini et al.
Journal: Biotechnol.Tech.
Year: 1988
Title: Killer sensitivity patterns as a tool for the fingerprinting of strains within the yeast speciesKluyveromyces lactis andK. Marxianus
Authors: Vaughan-Martini et al.
Journal: Biotechnol.Tech.
Year: 1988
DOI Number: 10.1016/S0723-2020(00)80077-6
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.3168/jds.S0022-0302(82)82465-X
Title: Alcohol and Single Cell Protein Production by Kluyveromyces in Concentrated Whey Permeates with Reduced Ash
Authors: Mahmoud, Kosikowski
Journal: J.Dairy Sci.
Year: 1982
Title: Alcohol and Single Cell Protein Production by Kluyveromyces in Concentrated Whey Permeates with Reduced Ash
Authors: Mahmoud, Kosikowski
Journal: J.Dairy Sci.
Year: 1982
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
