Taxon Name
Kluyveromyces dobzhanskii (El-Tabey Shehata et al.) Van der Walt
Accession number
6074
Form of supply
agar slant
Synonymous
Dekkeromyces dobzhanskii (El-Tabey Shehata et al.) Santa María & C. Sánchez, Guilliermondella dobzhanskii (El-Tabey Shehata et al.) Boidin et al., Kluyveromyces marxianus (E.C. Hansen) Van der Walt (E.C. Hansen) Van der Walt var. dobzhanskii (El-Tabey S
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24175; CBS 2104; CCRC 22022; IFO 10603; NCYC 538; NRRL Y-1974; UCD 50-45
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces dobzhanskii Shehata et al.
Isolation source
Drosophila pseudoobscura, fruit fly
Isolation Locality
USA – United States of America
Received from
Marty Miller – USA – University of California – Davis
LSU (D1/D2)
GenBank U69575; Kluyveromyces_dobzhanskii_DBVPG6074_D1D2 GCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTTACTTT GTAGCTGGTCCTTGTTTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTG TGGCGAGGATACCAGTTATATGTAAAGTACTTTCGACGAGTCGAGTTGTTTGGGAATGCA GCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA CAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAA TTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCA GCATCAGTTTTGGCGGCTGGATAAATCCTCGGGAATGTGGCTCTACCGTGGTAGAGTGTT ATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTG GCGTAATGGTTAAATGCCGCCCGTC
18S rRNA
GenBank X83822
ITS1&2
GenBank AY046215
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1073/pnas.96.24.13880
Title: Recurrent invasion and extinction of a selfish gene
Authors: Goddard, Burt
Journal: Proc.Natl.Acad.Sci.US
Year: 2000
DOI Number: 10.1080/00275514.1955.12024497
Title: Yeasts Isolated from Drosophila and From Their Suspected Feeding Places in Southern and Central California
Authors: Shehata et al.
Journal: Mycologia
Year: 1955
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1099/00207713-49-4-1899
Title: Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea
Authors: Nagahama et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
DOI Number: 10.1128/jb.111.2.481-487.1972
Title: Deoxyribonucleic Acid Base Composition of Species in the Yeast Genus Kluyveromyces van der Walt emend. van der Walt
Authors: Martini et al.
Journal: J.Bacteriol.
Year: 1972
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997

Richiedi informazioni

Inserisci i tuoi dati per ricevere informazioni su questo lievito

    Arrow Down
    Arrow Up