Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Kluyveromyces dobzhanskii (El-Tabey Shehata et al.) Van der Walt
Accession number
6074
Form of supply
agar slant
Synonymous
Dekkeromyces dobzhanskii (El-Tabey Shehata et al.) Santa María & C. Sánchez, Guilliermondella dobzhanskii (El-Tabey Shehata et al.) Boidin et al., Kluyveromyces marxianus (E.C. Hansen) Van der Walt (E.C. Hansen) Van der Walt var. dobzhanskii (El-Tabey S
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24175; CBS 2104; CCRC 22022; IFO 10603; NCYC 538; NRRL Y-1974; UCD 50-45
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces dobzhanskii Shehata et al.
Isolation source
Drosophila pseudoobscura, fruit fly
Isolation Locality
USA – United States of America
Received from
Miller – UCD, Davis, CA, USA
LSU (D1/D2)
GenBank U69575; Kluyveromyces_dobzhanskii_DBVPG6074_D1D2
GCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTTACTTT
GTAGCTGGTCCTTGTTTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTG
TGGCGAGGATACCAGTTATATGTAAAGTACTTTCGACGAGTCGAGTTGTTTGGGAATGCA
GCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA
CAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAA
TTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCA
GCATCAGTTTTGGCGGCTGGATAAATCCTCGGGAATGTGGCTCTACCGTGGTAGAGTGTT
ATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTG
GCGTAATGGTTAAATGCCGCCCGTC
18S rRNA
GenBank X83822
ITS1&2
GenBank AY046215
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Nagahama et al.. Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea. Int.J.Syst.Bacteriol. (1999), 49: 1899-1905 DOI: 10.1099/00207713-49-4-1899
Martini et al.. Deoxyribonucleic Acid Base Composition of Species in the Yeast Genus Kluyveromyces van der Walt emend. van der Walt. J.Bacteriol. (1972), 111: 481-487 DOI: 10.1128/jb.111.2.481-487.1972
Shehata et al.. Yeasts Isolated from Drosophila and From Their Suspected Feeding Places in Southern and Central California. Mycologia (1955), 47: 799-811 DOI: 10.1080/00275514.1955.12024497
Goddard, Burt. Recurrent invasion and extinction of a selfish gene. Proc.Natl.Acad.Sci.US (2000), 96: 13880-13885 DOI: 10.1073/pnas.96.24.13880
Ando et al.. Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs. Biosci.Biotechnol.Biochem. (1997), 60: 1063-1069 DOI: 10.1271/bbb.60.1063
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Cai et al.. Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences. Int.J.Syst.Bacteriol. (1996), 46: 542-549 DOI: 10.1099/00207713-46-2-542
Nagahama et al.. Kluyveromyces nonfermentans sp. nov., a new yeast species isolated from the deep sea. Int.J.Syst.Bacteriol. (1999), 49: 1899-1905 DOI: 10.1099/00207713-49-4-1899
Martini et al.. Deoxyribonucleic Acid Base Composition of Species in the Yeast Genus Kluyveromyces van der Walt emend. van der Walt. J.Bacteriol. (1972), 111: 481-487 DOI: 10.1128/jb.111.2.481-487.1972
Shehata et al.. Yeasts Isolated from Drosophila and From Their Suspected Feeding Places in Southern and Central California. Mycologia (1955), 47: 799-811 DOI: 10.1080/00275514.1955.12024497
Goddard, Burt. Recurrent invasion and extinction of a selfish gene. Proc.Natl.Acad.Sci.US (2000), 96: 13880-13885 DOI: 10.1073/pnas.96.24.13880
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito