Lievito - DBVPG

Taxon Name

Danielia oregonensis (Phaff & Carmo Souza) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai

Accession number

6149

Form of supply

agar slant

Synonymous

Candida obtusa Dietrichson ex van Uden & H.R. Buckley var. oregonensis (Phaff & do Carmo Sousa) Montrocher; Candida oregonensis Phaff & do Carmo-Sousa

Restrictions on use

For research use only

Nagoya protocol compliance conditions

Not under the scope of the CBD and the Nagoya protocol

Other Collections numbers

ATCC 42268; CBS 5036; CCRC 21575; DSM 5784; IFO 1980; JCM 1811; NRRL Y-5850; UCD 60-73

Risk Group

1

GMO

No

Status of the strain

Isotype of Candida oregonensis Phaff & do Carmo-Sousa

Isolation source

frass of Tsuga heterophylla

Isolation Locality

USA – United States of America

Received from

Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois

Date of deposit

04/02/1994

Collected by

LSU (D1/D2)

GenBank U44815; Danielia_oregonensis_DBVPG6149_D1D2 GCGGCAACGGCCCAAGTCCATTGGAACATGGCGCCAGGGAGGGTGAGAGCCCCGTCCGGCCACGCGCCGCGTCCGCAGTCTGCCCCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGCTTTTGCCGGGCCAGCATCGGTTTGGGGAGGCGGACAACCGCGGGAGCATGTGGCGCACCTCGGTGCGTGTTATAGCTCCCGTCCATACGCCTTCCCCAGTCCGAGGCCTGCGTTCTAAACTAGGATGCTGGCGTAATGGTTGCAAGCCGCC

18S rRNA

GenBank AB013545

Recommended growth temperature

25°C

Recommended growth medium

YPDA (Yeast Extract Peptone Glucose Agar)

Jpapers

Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998

DOI Number: 10.1007/BF02538734
Title: Four new species of yeast isolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent
Authors: Phaff, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962

DOI Number: 10.1016/j.biortech.2010.12.062
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011

DOI Number: 10.1016/j.enzmictec.2009.09.004
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009

DOI Number: 10.1016/S0723-2020(99)80030-7
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999

DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997

Scheda lievito

Richiedi informazioni