Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Lachancea kluyveri (Phaff, M.W. Miller & Shiffrine) Kurtzman
Accession number
6177
Form of supply
agar slant
Synonymous
Saccharomyces kluyveri Phaff et al., Torulaspora kluyveri (Phaff et al.) Kocková-Kratochvílová, Saccharomyces silvestris Jensen, Saccharomyces smittii Capriotti
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58438; CCRC 21498; CBS 3082; IFO 1685; JCM 7257; NCYC 543; NRRL Y-12651; UCD 51-242
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces kluyveri Phaff et al.
Isolation source
Drosophila pinicola, fruit fly
Received from
Rodrigues de Miranda – CBS, Delft, The Netherlands
Date of deposit
22/05/1978
LSU (D1/D2)
GenBank U68552; Lachancea_kluyveri_DBVPG6177_D1D2 GAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTTGGTGTCCGAGTTGTAATTTGAA
GAAGTAACTTTGGGGCTGATCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTG
AGAATCCCGTGTGGCGAGGAATTCAGTCCTATGTAAAGTGCTTTCGACGAGTCGAGTTGT
TTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGA
CCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAA
AGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTA
GCTCCTTGTGGGTTGGGATCTCGCAGCTCACTGGGCCAACATCAGTTTTGGCGGTGGGAT
AAATCCTTAGGAATGTGGCTTGTCTTCGGAGAAGTGTTATAGCCTAGGGGAATACCGCCA
GCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTAAATGCCGCCC
GTCTTG
18S rRNA
GenBank Z75580
ITS1&2
GenBank AY046209
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Phaff et al.. The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California. A.v.Leeuwenhoek (1956), 22: 145-161 DOI: 10.1007/BF02538322
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Vaughan-Martini, Kurtzman. Deoxyribonucleic Acid Relatedness among Species of the Genus Saccharomyces Sensu Stricto. Int.J.Syst.Bacteriol. (1985), 35: 508-511 DOI: 10.1099/00207713-35-4-508
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Daniel et al.. Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. Int.J.Syst.Evol.Microbiol. (2001), 51: 1593-1606 DOI: 10.1099/00207713-51-4-1593
Diezmann et al.. Phylogeny and evolution of medical species of candida and related taxa: A multigenic analysis. J.Clin.Microbiol. (2004), 42: 5624-5635 DOI: 10.1128/JCM.42.12.5624-5635.2004
Cliften et al.. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science (2003), 301: 71-76 DOI: 10.1126/science.1084337
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Naumov et al.. Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii. Syst.Appl.Microbiol. (1995), 18: 103-108 DOI: 10.1016/S0723-2020(11)80456-X
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Vaughan-Martini, Kurtzman. Deoxyribonucleic Acid Relatedness among Species of the Genus Saccharomyces Sensu Stricto. Int.J.Syst.Bacteriol. (1985), 35: 508-511 DOI: 10.1099/00207713-35-4-508
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Piskur et al.. Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces. Int.J.Syst.Bacteriol. (1998), 48: 1015-1024 DOI: 10.1099/00207713-48-3-1015
Daniel et al.. Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. Int.J.Syst.Evol.Microbiol. (2001), 51: 1593-1606 DOI: 10.1099/00207713-51-4-1593
Diezmann et al.. Phylogeny and evolution of medical species of candida and related taxa: A multigenic analysis. J.Clin.Microbiol. (2004), 42: 5624-5635 DOI: 10.1128/JCM.42.12.5624-5635.2004
Cliften et al.. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science (2003), 301: 71-76 DOI: 10.1126/science.1084337
Aono. Taxonomic Distribution of Alkali-tolerant Yeasts. Syst.Appl.Microbiol. (1990), 13: 394-397 DOI: 10.1016/S0723-2020(11)80239-0
Naumov et al.. Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii. Syst.Appl.Microbiol. (1995), 18: 103-108 DOI: 10.1016/S0723-2020(11)80456-X
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito