Taxon Name
Solicoccozyma aeria (Saito) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6237
Form of supply
agar slant
Synonymous
Cryptococcus aerius (Saito) Nann., Torula aeria Saito, Torulopsis aeria (Saito) Lodder var. aeria, Paratorulopsis aeria (Saito) Novak & Szolt, Cryptococcus albidus (Saito) C.E. Skinner var. aerius (Saito) Phaff & Fell
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 32039; CBS 4192; MUCL 30595; NRRL Y-2565
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis pseudoaeria Zsolt
Isolation source
soil of vineyard
Isolation Locality
HUN – Hungary
Received from
Rodrigues de Miranda – CBS, Delft, The Netherlands
Date of deposit
11/03/1983
LSU (D1/D2)
GenBank AF181544; Solicoccozyma_aeria_DBVPG6237_D1D2
AATTTGAAATCTGGCAGCCTCAGGTTGTCCGAGTTGTAATCTATAGAAACGTTTTCCGCG
CTGGCCCATGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTG
ACACGGACCACCAGTGCTTTGTGATACGTTTTCAACGAGTCGAGTTGTTTGGGAATGCAG
CTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC
AAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAAT
TGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGACTCAGCCGGTTCTGCCGGT
GTACTTCCTTTAGATGGGGTCAACATCAGTTTTGATCGCTGGAAAAGGGCGGGAGGAATG
TAGCACTCTCGGGTGAACTTATAGCCTTCCGTCGTATACAGTGGTTGGGACTGAGGAACG
CAGCATGCCTTTATGGCCGGGGTTCGCCCACGTACATGCTTAGGATGTTGACATAATGGC
TTTAAACGACCCGTCT
18S rRNA
GenBank AF444376
ITS1&2
GenBank AF444376
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
References
Zsolt. Torulopsis pseudaeria nov. spec., A new yeast from soil. A.v.Leeuwenhoek (1958), 24: 210-214 DOI: 10.1007/BF02548447
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Vaughan-Martini. Intraspecific discontinuity within the yeast speciesCryptococcus albidus as revealed bynDNA/nDNAreassociation. Exptl.Mycol. (1991), 15: 140-145 DOI: 10.1016/0147-5975(91)90014-5
Scorzetti et al.. Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. (2002), 2: 495-517 DOI: 10.1016/S1567-1356(02)00128-9
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Vaughan-Martini. Intraspecific discontinuity within the yeast speciesCryptococcus albidus as revealed bynDNA/nDNAreassociation. Exptl.Mycol. (1991), 15: 140-145 DOI: 10.1016/0147-5975(91)90014-5
Scorzetti et al.. Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. (2002), 2: 495-517 DOI: 10.1016/S1567-1356(02)00128-9
Buzzini et al.. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts. FEMS Yeast Res. (2005), 5: 379-385 DOI: 10.1016/j.femsyr.2004.10.011
Vancanneyt et al.. Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa. Syst.Appl.Microbiol. (1994), 17: 65-75 DOI: 10.1016/S0723-2020(11)80033-0
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito