Taxon Name
Scheffersomyces stipitis (Pignal) Kurtzman & M. Suzuki
Accession number
6264
Form of supply
agar slant
Synonymous
Pichia stipitis Pignal, Yamadazyma stipite (Pignal) Billon-Grand
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58376; CBS 5773; CCRC 21775; LY 1321; NRRL Y-7124
Risk Group
1
GMO
No
Status of the strain
Isotype of Pichia stipitis Pignal
Isolation source
insect larvae
Isolation Locality
FRA – France
Received from
Lennart Rodrigues de Miranda – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
28/05/1984
LSU (D1/D2)
GenBank U45741; Scheffersomyces_stipitis_DBVPG6264_D1D2 AGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAG
TTGTAATTTGAAGAAGGTAACTTTGGAGTCAGCTCTTGTCTATGTTCCTTGGAACAGGAC
GTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTGATTCTATGTAAAGTGCTTTCGA
AGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAA
AAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTA
TTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTACAGTTTACTGGGCCAGCATCGGTTTGG
ACGGTAGGATAATGACATTGGAATGTGGCACCACTTCGGTGGTGTGTTATAGACTTTGTT
GATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTT
AAACCGCCCGT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: A new ascosporogenous yeast genus: Yamadazyma gen.nov.
Authors: Billon-Grand
Journal: Mycotaxon
Year: 1989
Authors: Billon-Grand
Journal: Mycotaxon
Year: 1989
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1007/BF00400153
Title: Candida shehatae – Genetic diversity and phylogenetic relationships with other xylose-fermenting yeasts
Authors: Kurtzman
Journal: A.v.Leeuwenhoek
Year: 1990
Title: Candida shehatae – Genetic diversity and phylogenetic relationships with other xylose-fermenting yeasts
Authors: Kurtzman
Journal: A.v.Leeuwenhoek
Year: 1990
DOI Number: 10.1007/BF01982894
Title: Xylose fermentation by yeasts
Authors: Rizzi et al.
Journal: Appl.Microbiol.Biotechnol.
Year: 1988
Title: Xylose fermentation by yeasts
Authors: Rizzi et al.
Journal: Appl.Microbiol.Biotechnol.
Year: 1988
DOI Number: 10.1016/0922-338X(89)90080-9
Title: Purification and properties of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis
Authors: Rizzi et al.
Journal: J.Ferment.Bioeng.
Year: 1989
Title: Purification and properties of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis
Authors: Rizzi et al.
Journal: J.Ferment.Bioeng.
Year: 1989
DOI Number: 10.1016/S0168-1605(03)00248-4
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
DOI Number: 10.1111/j.1567-1364.2007.00342.x
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
