Taxon Name
Scheffersomyces stipitis (Pignal) Kurtzman & M. Suzuki
Accession number
6264
Form of supply
agar slant
Synonymous
Pichia stipitis Pignal, Yamadazyma stipite (Pignal) Billon-Grand
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58376; CBS 5773; CCRC 21775; LY 1321; NRRL Y-7124
Risk Group
1
GMO
No
Status of the strain
Isotype of Pichia stipitis Pignal
Isolation source
insect larvae
Isolation Locality
FRA – France
Received from
Rodrigues de Miranda – CBS, Delft, The Netherlands
Date of deposit
28/05/1984
LSU (D1/D2)
GenBank U45741; Scheffersomyces_stipitis_DBVPG6264_D1D2 AGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAG
TTGTAATTTGAAGAAGGTAACTTTGGAGTCAGCTCTTGTCTATGTTCCTTGGAACAGGAC
GTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTGATTCTATGTAAAGTGCTTTCGA
AGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAA
AAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTA
TTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTACAGTTTACTGGGCCAGCATCGGTTTGG
ACGGTAGGATAATGACATTGGAATGTGGCACCACTTCGGTGGTGTGTTATAGACTTTGTT
GATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTT
AAACCGCCCGT
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Kurtzman. Candida shehatae — Genetic diversity and phylogenetic relationships with other xylose-fermenting yeasts. A.v.Leeuwenhoek (1990), 57: 215-222 DOI: 10.1007/BF00400153
Vaughan-Martini. Ann.Fac.Agraria Univ.Perugia (1984), 38: 331-335
Rizzi et al.. Xylose fermentation by yeasts. Appl.Microbiol.Biotechnol. (1988), 29: 148-154 DOI: 10.1007/BF01982894
Pignal. Bull.Mens.Soc.Linn.Lyon (1967), 36: 163-168
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Rizzi et al.. Purification and properties of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis. J.Ferment.Bioeng. (1989), 67: 20-24 DOI: 10.1016/0922-338X(89)90080-9
Billon-Grand. Mycotaxon (1989), 35: 201-204
Vaughan-Martini. Ann.Fac.Agraria Univ.Perugia (1984), 38: 331-335
Rizzi et al.. Xylose fermentation by yeasts. Appl.Microbiol.Biotechnol. (1988), 29: 148-154 DOI: 10.1007/BF01982894
Pignal. Bull.Mens.Soc.Linn.Lyon (1967), 36: 163-168
Ponzoni et al.. Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin. Chem.Biodiv. (2008), 5: 471-483 DOI: 10.1002/cbdv.200890046
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Rizzi et al.. Purification and properties of the NAD+-xylitol-dehydrogenase from the yeast Pichia stipitis. J.Ferment.Bioeng. (1989), 67: 20-24 DOI: 10.1016/0922-338X(89)90080-9
Billon-Grand. Mycotaxon (1989), 35: 201-204
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito