Taxon Name
Papiliotrema laurentii (Kuff.) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout
Accession number
6265
Form of supply
agar slant
Synonymous
Cryptococcus laurentii (Kufferath) C.E. Skinner, Rhodotorula laurentii (Kufferath) T. Hasegawa et al., Torula laurentii Kufferath, Torulopsis laurentii (Kufferath) Lodder, Rhodotorula flavescens (Saito) Krassil\\\\
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 18803; CBS 139; CCRC 20527; IGC 3966; IFO 0609; MUCL 30398; NRRL Y-2536; VKM Y-1665; VKPM Y 219; JCM 9066; UCD 68-201; DBVPG 6640
Risk Group
1
GMO
No
Status of the strain
Isotype of Torula laurentii Kufferath
Isolation source
palm wine
Isolation Locality
COG – Congo
Received from
Date of deposit
10/01/1984
LSU (D1/D2)
GenBank AF075469; Papiliotrema_laurentii_DBVPG6265_D1D2
AAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGT
GCCGGACCGTGTCCAAGTTCCTTGGAACAGGATATCAAAGAGGGTGACAATCCCGTACTT
GACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAG
CTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC
AAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT
TGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGT
GTATTCCCCTCGGTCGGGTCAACATCAGTTTTGTCCGGTGGATAAGGACGGTAGGAAGGT
GGCACCCTCGGGTGTGTTATAGCCTGCCGTCGCATACATCGGGTGAGACTGAGGAACGCA
GCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTT
TAAACGACCCGTCTTGA
18S rRNA
GenBank AB032640
ITS1&2
GenBank AF410468
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1002/ptr.1622
Title: In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains
Authors: Turchetti et al.
Journal: Phytother.Res.
Year: 2005
Title: In vitro Antimycotic Activity of Some Plant Extracts Towards Yeast and Yeast-like Strains
Authors: Turchetti et al.
Journal: Phytother.Res.
Year: 2005
DOI Number: 10.1016/j.bmcl.2008.05.048
Title: Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms
Authors: Buzzini et al.
Journal: Bioorg.Med.Chem.Lett.
Year: 2008
Title: Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms
Authors: Buzzini et al.
Journal: Bioorg.Med.Chem.Lett.
Year: 2008
DOI Number: 10.1016/j.fgb.2004.09.005
Title: A cluster of NIF transcriptional regulators with divergent patterns of spore-specific expression in Phytophthora infestans
Authors: Butler, Poulter
Journal: Fungal.Genet.Biol.
Year: 2005
Title: A cluster of NIF transcriptional regulators with divergent patterns of spore-specific expression in Phytophthora infestans
Authors: Butler, Poulter
Journal: Fungal.Genet.Biol.
Year: 2005
DOI Number: 10.1016/j.jpba.2005.11.031
Title: Growth, lipid accumulation, and fatty acid composition in obligate psychrophilic, facultative psychrophilic, and mesophilic yeasts
Authors: Rossi et al.
Journal: J.Pharm.Biomed.Anal.
Year: 2009
Title: Growth, lipid accumulation, and fatty acid composition in obligate psychrophilic, facultative psychrophilic, and mesophilic yeasts
Authors: Rossi et al.
Journal: J.Pharm.Biomed.Anal.
Year: 2009
DOI Number: 10.1016/S0367-326X(03)00047-9
Title: Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms
Authors: Buzzini, Pieroni
Journal: Fitoterapia
Year: 2003
Title: Antimicrobial activity of extracts of Clematis vitalba towards pathogenic yeast and yeast-like microorganisms
Authors: Buzzini, Pieroni
Journal: Fitoterapia
Year: 2003
DOI Number: 10.1016/S0723-2020(11)80033-0
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
Title: Whole-cell Protein Patterns, DNA Base Compositions and Coenzyme Q Types in the Yeast Genus Cryptococcus Kützing and Related Taxa
Authors: Vancanneyt et al.
Journal: Syst.Appl.Microbiol.
Year: 1994
DOI Number: 10.1016/S0723-2020(11)80239-0
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
Title: Taxonomic Distribution of Alkali-tolerant Yeasts
Authors: Aono
Journal: Syst.Appl.Microbiol.
Year: 1990
DOI Number: 10.1099/00207713-49-2-907
Title: Cystofilobasidiales, a new order of basidiomycetous yeasts
Authors: Fell et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Cystofilobasidiales, a new order of basidiomycetous yeasts
Authors: Fell et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
DOI Number: 10.1111/j.1574-6968.2000.tb09142.x
Title: Phylogenetic analysis of Xylaria based on nuclear ribosomal ITS1-5.8S-ITS2 sequences
Authors: Lee et al.
Journal: FEMS Microbiol.Lett.
Year: 2000
Title: Phylogenetic analysis of Xylaria based on nuclear ribosomal ITS1-5.8S-ITS2 sequences
Authors: Lee et al.
Journal: FEMS Microbiol.Lett.
Year: 2000
DOI Number: 10.1128/JCM.39.11.4042-4051.2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
DOI Number: 10.1139/w00-032
Title: Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest
Authors: Buzzini, Martini
Journal: Can.J.Microbiol.
Year: 2000
Title: Biodiversity of killer activity in yeasts isolated from the Brazilian rain forest
Authors: Buzzini, Martini
Journal: Can.J.Microbiol.
Year: 2000
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
