Taxon Name
Sungouiella intermedia (Cif. & Ashford) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai
Accession number
6286
Form of supply
agar slant
Synonymous
Blastodendrion intermedium Ciferri & Ashford, Cryptococcus intermedius (Ciferri & Ashford) Nannizzi, Mycotorula intermedia (Ciferri & Ashford) Krasil
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 7153; IFO 10601; NRRL Y-12509
Risk Group
1
GMO
No
Isolation Locality
USA – United States of America
Received from
Maudy Smith – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
17/02/1986
LSU (D1/D2)
GenBank AJ508588; Sungouiella_intermedia_DBVPG6286_D1D2 AACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGGTTGGGAGACCCCGCGGCTAGTGGCACCAAGTCCCTTGGAACAGGGCGCCTTAGAGGGTGAGAGCCCCGTAGGTACCACAATACCGTCTTGTGTCTCCTCTCCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGCCTTCGTGCCGGGCCAGCATCGGTTGCTAGGGGTGGATAAGGAACAAGGAATGTAGCTCCTCGGAGTATTATAGCCTTGCGCGATACACCCACTGGCGACCGAGGCCTGCGGTATTCTTTACCTAGGATGCTGGCGTAATGGTTGCAAGCCGCCCGTCTTGAACACGGACC
18S rRNA
GenBank X89518
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1007/BF00572123
Title: Assignment of Kluyveromyces cellobiovorus nomen nudum to Candida intermedia (Ciferri & Ashford) Langeron et Guerra
Authors: Martini, Vaughan-Martini
Journal: A.v.Leeuwenhoek
Year: 1992
Title: Assignment of Kluyveromyces cellobiovorus nomen nudum to Candida intermedia (Ciferri & Ashford) Langeron et Guerra
Authors: Martini, Vaughan-Martini
Journal: A.v.Leeuwenhoek
Year: 1992
DOI Number: 10.1016/S0168-1605(03)00248-4
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
DOI Number: 10.1111/j.1567-1364.2007.00342.x
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
