Taxon Name
Lachancea fermentati (H. Naganishi) Kurtzman
Accession number
6297
Form of supply
agar slant
Synonymous
Saccharomyces montanus Phaff et al., Torulaspora montana (Phaff et al.) Kocková-Kratochvílová, Zygosaccharomyces fermentati H. Naganishi, Debaryomyces manchuricus H. Naganishi, Saccharomyces albasitensis Santa María, Saccharomyces amurcae Van der Walt
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58446; CBS 707; CCRC 21760; IFO 0479; NRRL Y-1559; CECT 11056
Risk Group
1
GMO
No
Status of the strain
Isotype of Zygosaccharomyces fermentati H. Naganishi; Isotype of Saccharomyces montanus Phaff et al.
Isolation source
sedimeEx-type of peppermiEx-type
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
15/08/1986
LSU (D1/D2)
GenBank U84239; Lachancea_fermentati_DBVPG6297_D1D2 GCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAA
GCAACTTTGGTGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGA
ATCCCGTGTGGCGAGGATCCCAGTGCTATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTG
GGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCG
ATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGT
ACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTCGCT
CCTTGTGGGTGGGGATCTCGCAGCTCACTGGGCCAACATCGGTTTTGGCGGCAGGATAAA
ACTTTGGGAATGTAGCTTGTCTTCGGAGAAGTATTATAGCCCAAGGCAATACTGCCAGCC
GGGACCGAGGACTGCGACTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGCCCGTCT
TGAACCACGGACC
18S rRNA
GenBank X77930
ITS1&2
GenBank AY046206
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Phaff et al.. The taxonomy of yeasts isolated fromDrosophila in the Yosemite region of California. A.v.Leeuwenhoek (1956), 22: 145-161 DOI: 10.1007/BF02538322
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int.J.Syst.Bacteriol. (1996), 46: 189-194 DOI: 10.1099/00207713-46-1-189
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Naganishi. J.Zymolog. (1928), 6: 1-12
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Kurtzman. DNA relatedness among species of the genus Zygosaccharomyces. Yeast (1990), 6: 213-219 DOI: 10.1002/yea.320060306
James et al.. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small‐subunit rRNA gene sequences. Yeast (1994), 10: 871-881 DOI: 10.1002/yea.320100703
Turakainen et al.. Characterization of MEL genes in the genus Zygosaccharomyces. Yeast (1994), 10: 733-745 DOI: 10.1002/yea.320100605
Kurtzman, Robnett. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A.v.Leeuwenhoek (1998), 73: 331-371 DOI: 10.1023/A:1001761008817
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int.J.Syst.Bacteriol. (1996), 46: 189-194 DOI: 10.1099/00207713-46-1-189
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Naganishi. J.Zymolog. (1928), 6: 1-12
Buzzini, Martini. Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera. Syst.Appl.Microbiol. (2000), 23: 450-457 DOI: 10.1016/S0723-2020(00)80077-6
Kurtzman. DNA relatedness among species of the genus Zygosaccharomyces. Yeast (1990), 6: 213-219 DOI: 10.1002/yea.320060306
James et al.. Genetic interrelationship among species of the genus Zygosaccharomyces as revealed by small‐subunit rRNA gene sequences. Yeast (1994), 10: 871-881 DOI: 10.1002/yea.320100703
Turakainen et al.. Characterization of MEL genes in the genus Zygosaccharomyces. Yeast (1994), 10: 733-745 DOI: 10.1002/yea.320100605
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito