Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Jamesozyma lodderae (van der Walt & Tscheuschner) Q.M. Wang, Yurkov & Boekhout
Accession number
6308
Form of supply
agar slant
Synonymous
Kazachstania lodderae (van der Walt & Tscheuschner) Kurtzman, Dekkeromyces lodderae (Van der Walt & Tscheuschner) E.K. Novák & Zsolt, Guilliermondella lodderae (Van der Walt & Tscheuschner) Boidin et al., Kluyveromyces lodderae (Van der Walt & Tscheuschner) Van der Walt, Saccharomyces lodderae Van der Walt & Tscheuschner, Zygofabospora lodderae (Van der Walt et Tscheuschner) Naumov
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 24206; CBS 2757; CCRC 22117; IFO 10606; NCYC 1417; NRRL Y-8280; UCD 70-3
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces lodderae Van der Walt & Tscheuschner
Isolation source
soil
Isolation Locality
ZAF – South Africa
Received from
Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois
Date of deposit
20/03/1987
LSU (D1/D2)
GenBank U68551; Jamesozyma_lodderae_DBVPG6308_D1D2
AGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTCGGTGCTCGAGTTGTAATTTGTAGA
GGGATACTTTGGGGCCGTTCCTTATCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGA
GAATCCCGTATGATGAGGAGTGCGGTTCTATGTAAAGTGCTCTCGAAGAGTCGAGTTGTT
TGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAC
CGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAA
GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTG
CTCCTTGTGGGTGGGGGACTCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGA
TAAATCTGTAGGAATGTAGCTTGCTTCGGGAAGTGTTATAGCCTGCGGGAATACTGCCAG
CTGGGATTGAGGACTGCGACATTCGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCG
TC
18S rRNA
GenBank X83824
ITS1&2
GenBank AY046160
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/cbdv.200890046
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
Title: Biotransformation of Acyclic Monoterpenoids by Debaryomyces sp., Kluyveromyces sp., and Pichia sp. Strains of Environmental Origin
Authors: Ponzoni et al.
Journal: Chem.Biodiv.
Year: 2008
DOI Number: 10.1007/BF02545868
Title: Three new yeasts
Authors: van der Walt, Tscheuschner
Journal: A.v.Leeuwenhoek
Year: 1957
Title: Three new yeasts
Authors: van der Walt, Tscheuschner
Journal: A.v.Leeuwenhoek
Year: 1957
DOI Number: 10.1016/j.biortech.2010.12.062
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
DOI Number: 10.1016/j.enzmictec.2009.09.004
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
DOI Number: 10.1016/j.mimet.2010.09.007
Title: Rapid method for screening enoate reductase activity in yeasts
Authors: Raimondi et al.
Journal: J.Microbiol.Methods.
Year: 2010
Title: Rapid method for screening enoate reductase activity in yeasts
Authors: Raimondi et al.
Journal: J.Microbiol.Methods.
Year: 2010
DOI Number: 10.1016/j.tetasy.2008.08.011
Title: Chemoenzymatic and yeast-catalysed synthesis of diastereomeric ethyl c-phenyl and c-(n-pyridyl)paraconates
Authors: Forzato et al.
Journal: Tetrahedron Asimmetry
Year: 2008
Title: Chemoenzymatic and yeast-catalysed synthesis of diastereomeric ethyl c-phenyl and c-(n-pyridyl)paraconates
Authors: Forzato et al.
Journal: Tetrahedron Asimmetry
Year: 2008
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1271/bbb.60.1063
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Title: Phylogenetic Relationships of Species of the Genus Kluyveromyces van der Walt (Saccharomycetaceae) Deduced from the Partial Sequences of 18S and 26S Ribosomal RNAs
Authors: Ando et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1997
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito