Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Monosporozyma servazzii (Capr.) Q.M. Wang, Yurkov & Boekhout
Accession number
6355
Form of supply
agar slant
Synonymous
Saccharomyces servazzii Capriotti, Kazachstania servazzii (Capriotti) Kurtzman
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 58439; CBS 4311; CCRC 21501; IFO 1838; JCM 5129; NCYC 2577; NRRL Y-12661
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces servazzii Capriotti
Isolation source
soil
Isolation Locality
FIN – Finland
Received from
Date of deposit
10/10/1987
LSU (D1/D2)
GenBank U68558; GenBank AY048157; Monosporozyma_servazzii_DBVPG6355_D1D2 AGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTCGGTGCTCGAG
TTGTAATTTGTAGAGGGATACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGAC
GTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTATGTAAAGTGCCTTCGA
AGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAA
TATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAA
AAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTG
TTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGACTCTCGCAGCTCACTGGGCCAACATCAG
TTTTGGTGGTCGGACAAATCCGTAGGAATGTAGCTTACCTCGGTAAGTGTTATAGCCTGC
GGGAATACGGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGG
TTATATGCCGCCCGTCT
18S rRNA
GenBank AY251643
ITS1&2
GenBank AY046153
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Pheromone activity of collection strains of Saccharomyces sensu lato yeasts
Authors: Naumov, Piskur
Journal: Microbiology
Year: 1999
Authors: Naumov, Piskur
Journal: Microbiology
Year: 1999
Title: Saccharomyces servazzii n. sp. A new yeast from Finland soil
Authors: Capriotti
Journal: Ann.Microbiol.Enzimol.
Year: 1967
Authors: Capriotti
Journal: Ann.Microbiol.Enzimol.
Year: 1967
DOI Number: 10.1007/BF02565038
Title: DNA base composition of species of the genus Saccharomyces
Authors: Yarrow, Nakase
Journal: A.v.Leeuwenhoek
Year: 1975
Title: DNA base composition of species of the genus Saccharomyces
Authors: Yarrow, Nakase
Journal: A.v.Leeuwenhoek
Year: 1975
DOI Number: 10.1016/S0014-5793(00)02272-9
Title: Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies
Authors: Souciet et al.
Journal: FEBS Lett.
Year: 2001
Title: Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies
Authors: Souciet et al.
Journal: FEBS Lett.
Year: 2001
DOI Number: 10.1016/S0014-5793(00)02278-X
Title: Genomic Exploration of the Hemiascomycetous Yeasts: 7. Saccharomyces servazzii
Authors: Casaregola et al.
Journal: FEBS Lett.
Year: 2001
Title: Genomic Exploration of the Hemiascomycetous Yeasts: 7. Saccharomyces servazzii
Authors: Casaregola et al.
Journal: FEBS Lett.
Year: 2001
DOI Number: 10.1016/S0723-2020(00)80077-6
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
Title: Utilisation of differential killer toxin sensitivity patterns for fingerprinting and clustering yeast strains belonging to different genera
Authors: Buzzini, Martini
Journal: Syst.Appl.Microbiol.
Year: 2000
DOI Number: 10.1016/S0723-2020(11)80456-X
Title: Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii
Authors: Naumov et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
Title: Karyotypic Relationships among Species of Saccharomyces sensu lato: S. castellii, S. dairensis, S. unisporus and S. servazzii
Authors: Naumov et al.
Journal: Syst.Appl.Microbiol.
Year: 1995
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1017.S1355838202022082
Title: Phylogenetic analysis of the structure of RNase MRP RNA in yeasts
Authors: Li et al.
Journal: RNA
Year: 2002
Title: Phylogenetic analysis of the structure of RNase MRP RNA in yeasts
Authors: Li et al.
Journal: RNA
Year: 2002
DOI Number: 10.1038/nature01419
Title: Yeast genome duplication was followed by asynchronous differentiation of duplicated genes
Authors: Langkjaer et al.
Journal: Nature
Year: 2003
Title: Yeast genome duplication was followed by asynchronous differentiation of duplicated genes
Authors: Langkjaer et al.
Journal: Nature
Year: 2003
DOI Number: 10.1080/00275514.1988.12025526
Title: Deoxyribonucleic Acid Relatedness Among Species of Saccharomyces Sensu Lato
Authors: Vaughan-Martini, Kurtzman
Journal: Mycologia
Year: 1988
Title: Deoxyribonucleic Acid Relatedness Among Species of Saccharomyces Sensu Lato
Authors: Vaughan-Martini, Kurtzman
Journal: Mycologia
Year: 1988
DOI Number: 10.1093/nar/gkg423
Title: Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts
Authors: Langkjaer et al.
Journal: Nucleic Acids Res.
Year: 2003
Title: Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts
Authors: Langkjaer et al.
Journal: Nucleic Acids Res.
Year: 2003
DOI Number: 10.1099/00207713-47-2-453
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
DOI Number: 10.1099/00207713-48-3-1015
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
Title: Structure and genetic stability of mitochondrial genomes vary among yeasts of the genus Saccharomyces
Authors: Piskur et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1998
DOI Number: 10.1099/00207713-49-1-319
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito