Taxon Name
Pachysolen tannophilus Boidin & Adzet
Accession number
6666
Form of supply
agar slant
Synonymous
Hansenula tannophila (Boidin & Azet) Campbell, Pachysolen pelliculatus Boidin & Adzet
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 32691; CBS 4044; CCRC 20329; DBVPG 7319; DBVPG 6194; IMI 344640; MUCL 31901; NCYC 614; NRRL Y-2460; UCD 58-5
Risk Group
1
GMO
No
Status of the strain
Isotype of Pachysolen tannophilus Boidin & Adzet
Isolation source
concentrated tanning fluid
Isolation Locality
FRA – France
Received from
Marty Miller – USA – University of California – Davis
Date of deposit
28/08/1989
Collected by
LSU (D1/D2)
GenBank U76346; Pachysolen_tannophilus_DBVPG6666_D1D2 TTCAGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGATCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGGGGAATCCAGATCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTTGGATCAGACTTGGTGTTTAGTACTCTTCACTCCTTGTGGGTGGGGCTCTTGCTTTATACTGGGCTAGCATCGGTTTGGGTGGTAGGATAATGACATTGGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCCTTTGTTGATACTACCTACCTAGACCGAGGACTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCCAAAGCCGCCCGT
18S rRNA
GenBank AF132030
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1002/yea.320060208
Title: Cloning and sequencing of the ornithine carbamoyltransferase gene from Pachysolen tannophilus
Authors: Skrzypek et al.
Journal: Yeast
Year: 1990
DOI Number: 10.1016/0141-0229(94)00046-T
Title: Response surface optimization of temperature and pH for the growth of Pachysolen tannophilus
Authors: Roebuck et al.
Journal: Enzyme Microb.Tech.
Year: 1995
DOI Number: 10.1016/0378-1119(94)90742-0
Title: A gene homologous to that encoding UDP galactose-4-epimerase is inducible by xylose in the yeast Pachysolen tannophilus
Authors: Skrzypek, Maleszka
Journal: Gene
Year: 1994
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998

Richiedi informazioni

Inserisci i tuoi dati per ricevere informazioni su questo lievito

    Arrow Down
    Arrow Up